ID: 929364713

View in Genome Browser
Species Human (GRCh38)
Location 2:41139825-41139847
Sequence AACTTTATGCTGTGATCTTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
929364713_929364716 6 Left 929364713 2:41139825-41139847 CCTCAAGATCACAGCATAAAGTT No data
Right 929364716 2:41139854-41139876 CTTGTGGGCATGTTTGTGTACGG No data
929364713_929364714 -10 Left 929364713 2:41139825-41139847 CCTCAAGATCACAGCATAAAGTT No data
Right 929364714 2:41139838-41139860 GCATAAAGTTCAGATACTTGTGG No data
929364713_929364717 7 Left 929364713 2:41139825-41139847 CCTCAAGATCACAGCATAAAGTT No data
Right 929364717 2:41139855-41139877 TTGTGGGCATGTTTGTGTACGGG No data
929364713_929364715 -9 Left 929364713 2:41139825-41139847 CCTCAAGATCACAGCATAAAGTT No data
Right 929364715 2:41139839-41139861 CATAAAGTTCAGATACTTGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
929364713 Original CRISPR AACTTTATGCTGTGATCTTG AGG (reversed) Intergenic