ID: 929364714

View in Genome Browser
Species Human (GRCh38)
Location 2:41139838-41139860
Sequence GCATAAAGTTCAGATACTTG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
929364713_929364714 -10 Left 929364713 2:41139825-41139847 CCTCAAGATCACAGCATAAAGTT No data
Right 929364714 2:41139838-41139860 GCATAAAGTTCAGATACTTGTGG No data
929364710_929364714 25 Left 929364710 2:41139790-41139812 CCAAGAAGGCGTGTGTGAAGTAA No data
Right 929364714 2:41139838-41139860 GCATAAAGTTCAGATACTTGTGG No data
929364712_929364714 -9 Left 929364712 2:41139824-41139846 CCCTCAAGATCACAGCATAAAGT No data
Right 929364714 2:41139838-41139860 GCATAAAGTTCAGATACTTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
929364714 Original CRISPR GCATAAAGTTCAGATACTTG TGG Intergenic