ID: 929364717 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 2:41139855-41139877 |
Sequence | TTGTGGGCATGTTTGTGTAC GGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
929364713_929364717 | 7 | Left | 929364713 | 2:41139825-41139847 | CCTCAAGATCACAGCATAAAGTT | No data | ||
Right | 929364717 | 2:41139855-41139877 | TTGTGGGCATGTTTGTGTACGGG | No data | ||||
929364712_929364717 | 8 | Left | 929364712 | 2:41139824-41139846 | CCCTCAAGATCACAGCATAAAGT | No data | ||
Right | 929364717 | 2:41139855-41139877 | TTGTGGGCATGTTTGTGTACGGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
929364717 | Original CRISPR | TTGTGGGCATGTTTGTGTAC GGG | Intergenic | ||