ID: 929366241

View in Genome Browser
Species Human (GRCh38)
Location 2:41159917-41159939
Sequence TGTAACAAGTGACCCCAAGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
929366239_929366241 -6 Left 929366239 2:41159900-41159922 CCCATGCTATTGGCTGCTGTAAC No data
Right 929366241 2:41159917-41159939 TGTAACAAGTGACCCCAAGTTGG No data
929366240_929366241 -7 Left 929366240 2:41159901-41159923 CCATGCTATTGGCTGCTGTAACA No data
Right 929366241 2:41159917-41159939 TGTAACAAGTGACCCCAAGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
929366241 Original CRISPR TGTAACAAGTGACCCCAAGT TGG Intergenic
No off target data available for this crispr