ID: 929372052

View in Genome Browser
Species Human (GRCh38)
Location 2:41237188-41237210
Sequence TATTACTTATAGTAACTGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
929372050_929372052 1 Left 929372050 2:41237164-41237186 CCTGTTTGTGAATGCTTATTGCA No data
Right 929372052 2:41237188-41237210 TATTACTTATAGTAACTGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
929372052 Original CRISPR TATTACTTATAGTAACTGGA AGG Intergenic
No off target data available for this crispr