ID: 929372445

View in Genome Browser
Species Human (GRCh38)
Location 2:41242224-41242246
Sequence ACGAACAAAAGTGCCTTTGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
929372445_929372448 6 Left 929372445 2:41242224-41242246 CCCACAAAGGCACTTTTGTTCGT No data
Right 929372448 2:41242253-41242275 CTGCAAAACCAGTGTTTCTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
929372445 Original CRISPR ACGAACAAAAGTGCCTTTGT GGG (reversed) Intergenic
No off target data available for this crispr