ID: 929376977

View in Genome Browser
Species Human (GRCh38)
Location 2:41299298-41299320
Sequence GTGTATGTGCAGGAGGTGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
929376977_929376984 11 Left 929376977 2:41299298-41299320 CCCTCCACCTCCTGCACATACAC No data
Right 929376984 2:41299332-41299354 CCTGCTTCCTCCCTCCCTGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
929376977 Original CRISPR GTGTATGTGCAGGAGGTGGA GGG (reversed) Intergenic
No off target data available for this crispr