ID: 929377246

View in Genome Browser
Species Human (GRCh38)
Location 2:41302887-41302909
Sequence GCGAATCCTGTATTTCTGAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
929377246_929377249 -6 Left 929377246 2:41302887-41302909 CCCATCAGAAATACAGGATTCGC No data
Right 929377249 2:41302904-41302926 ATTCGCTAGGCTGTAAAGTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
929377246 Original CRISPR GCGAATCCTGTATTTCTGAT GGG (reversed) Intergenic
No off target data available for this crispr