ID: 929386745

View in Genome Browser
Species Human (GRCh38)
Location 2:41416908-41416930
Sequence AGGTAACACCTACCTCTCAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
929386745_929386749 12 Left 929386745 2:41416908-41416930 CCACTGAGAGGTAGGTGTTACCT No data
Right 929386749 2:41416943-41416965 TACTTTTCCAAAGTGTATTAGGG No data
929386745_929386748 11 Left 929386745 2:41416908-41416930 CCACTGAGAGGTAGGTGTTACCT No data
Right 929386748 2:41416942-41416964 GTACTTTTCCAAAGTGTATTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
929386745 Original CRISPR AGGTAACACCTACCTCTCAG TGG (reversed) Intergenic
No off target data available for this crispr