ID: 929386747

View in Genome Browser
Species Human (GRCh38)
Location 2:41416928-41416950
Sequence GAAAAGTACCAAAGTAACAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
929386747_929386754 28 Left 929386747 2:41416928-41416950 CCTCTGTTACTTTGGTACTTTTC No data
Right 929386754 2:41416979-41417001 CAGAGCCAACAGAAGATGTGGGG No data
929386747_929386748 -9 Left 929386747 2:41416928-41416950 CCTCTGTTACTTTGGTACTTTTC No data
Right 929386748 2:41416942-41416964 GTACTTTTCCAAAGTGTATTAGG No data
929386747_929386749 -8 Left 929386747 2:41416928-41416950 CCTCTGTTACTTTGGTACTTTTC No data
Right 929386749 2:41416943-41416965 TACTTTTCCAAAGTGTATTAGGG No data
929386747_929386752 26 Left 929386747 2:41416928-41416950 CCTCTGTTACTTTGGTACTTTTC No data
Right 929386752 2:41416977-41416999 AACAGAGCCAACAGAAGATGTGG No data
929386747_929386753 27 Left 929386747 2:41416928-41416950 CCTCTGTTACTTTGGTACTTTTC No data
Right 929386753 2:41416978-41417000 ACAGAGCCAACAGAAGATGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
929386747 Original CRISPR GAAAAGTACCAAAGTAACAG AGG (reversed) Intergenic
No off target data available for this crispr