ID: 929386748

View in Genome Browser
Species Human (GRCh38)
Location 2:41416942-41416964
Sequence GTACTTTTCCAAAGTGTATT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
929386745_929386748 11 Left 929386745 2:41416908-41416930 CCACTGAGAGGTAGGTGTTACCT No data
Right 929386748 2:41416942-41416964 GTACTTTTCCAAAGTGTATTAGG No data
929386747_929386748 -9 Left 929386747 2:41416928-41416950 CCTCTGTTACTTTGGTACTTTTC No data
Right 929386748 2:41416942-41416964 GTACTTTTCCAAAGTGTATTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
929386748 Original CRISPR GTACTTTTCCAAAGTGTATT AGG Intergenic
No off target data available for this crispr