ID: 929386750

View in Genome Browser
Species Human (GRCh38)
Location 2:41416950-41416972
Sequence TGGAGAACCCTAATACACTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
929386750_929386754 6 Left 929386750 2:41416950-41416972 CCAAAGTGTATTAGGGTTCTCCA No data
Right 929386754 2:41416979-41417001 CAGAGCCAACAGAAGATGTGGGG No data
929386750_929386753 5 Left 929386750 2:41416950-41416972 CCAAAGTGTATTAGGGTTCTCCA No data
Right 929386753 2:41416978-41417000 ACAGAGCCAACAGAAGATGTGGG No data
929386750_929386752 4 Left 929386750 2:41416950-41416972 CCAAAGTGTATTAGGGTTCTCCA No data
Right 929386752 2:41416977-41416999 AACAGAGCCAACAGAAGATGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
929386750 Original CRISPR TGGAGAACCCTAATACACTT TGG (reversed) Intergenic
No off target data available for this crispr