ID: 929386753

View in Genome Browser
Species Human (GRCh38)
Location 2:41416978-41417000
Sequence ACAGAGCCAACAGAAGATGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
929386750_929386753 5 Left 929386750 2:41416950-41416972 CCAAAGTGTATTAGGGTTCTCCA No data
Right 929386753 2:41416978-41417000 ACAGAGCCAACAGAAGATGTGGG No data
929386747_929386753 27 Left 929386747 2:41416928-41416950 CCTCTGTTACTTTGGTACTTTTC No data
Right 929386753 2:41416978-41417000 ACAGAGCCAACAGAAGATGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
929386753 Original CRISPR ACAGAGCCAACAGAAGATGT GGG Intergenic
No off target data available for this crispr