ID: 929388884

View in Genome Browser
Species Human (GRCh38)
Location 2:41444639-41444661
Sequence TGTTATATGCATAAATAGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
929388882_929388884 4 Left 929388882 2:41444612-41444634 CCTTGATAAAGTATGTTGCTTAA No data
Right 929388884 2:41444639-41444661 TGTTATATGCATAAATAGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
929388884 Original CRISPR TGTTATATGCATAAATAGGA TGG Intergenic
No off target data available for this crispr