ID: 929392101

View in Genome Browser
Species Human (GRCh38)
Location 2:41481622-41481644
Sequence CAGGGGAAAGAGAATGAGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
929392092_929392101 24 Left 929392092 2:41481575-41481597 CCTTCATAACATTTGTTTTGCCA No data
Right 929392101 2:41481622-41481644 CAGGGGAAAGAGAATGAGGCAGG No data
929392095_929392101 4 Left 929392095 2:41481595-41481617 CCAAGAATAGATGGGTAGTAATA No data
Right 929392101 2:41481622-41481644 CAGGGGAAAGAGAATGAGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
929392101 Original CRISPR CAGGGGAAAGAGAATGAGGC AGG Intergenic
No off target data available for this crispr