ID: 929392735

View in Genome Browser
Species Human (GRCh38)
Location 2:41489982-41490004
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
929392729_929392735 14 Left 929392729 2:41489945-41489967 CCTCAAGGCTGTTGGCTAGAGGC No data
Right 929392735 2:41489982-41490004 TGCCATGTGGACCTTTCTAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type