ID: 929400198

View in Genome Browser
Species Human (GRCh38)
Location 2:41571211-41571233
Sequence CAAGGTATGCCAGGTGTACC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
929400198_929400205 28 Left 929400198 2:41571211-41571233 CCTGGTACACCTGGCATACCTTG No data
Right 929400205 2:41571262-41571284 CAAAGAAGCATGAATCTAAATGG No data
929400198_929400201 5 Left 929400198 2:41571211-41571233 CCTGGTACACCTGGCATACCTTG No data
Right 929400201 2:41571239-41571261 TACCATGAGCACATGCACCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
929400198 Original CRISPR CAAGGTATGCCAGGTGTACC AGG (reversed) Intergenic
No off target data available for this crispr