ID: 929400199

View in Genome Browser
Species Human (GRCh38)
Location 2:41571220-41571242
Sequence GGTAGTATGCAAGGTATGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
929400199_929400205 19 Left 929400199 2:41571220-41571242 CCTGGCATACCTTGCATACTACC No data
Right 929400205 2:41571262-41571284 CAAAGAAGCATGAATCTAAATGG No data
929400199_929400201 -4 Left 929400199 2:41571220-41571242 CCTGGCATACCTTGCATACTACC No data
Right 929400201 2:41571239-41571261 TACCATGAGCACATGCACCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
929400199 Original CRISPR GGTAGTATGCAAGGTATGCC AGG (reversed) Intergenic
No off target data available for this crispr