ID: 929400201

View in Genome Browser
Species Human (GRCh38)
Location 2:41571239-41571261
Sequence TACCATGAGCACATGCACCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
929400199_929400201 -4 Left 929400199 2:41571220-41571242 CCTGGCATACCTTGCATACTACC No data
Right 929400201 2:41571239-41571261 TACCATGAGCACATGCACCCAGG No data
929400198_929400201 5 Left 929400198 2:41571211-41571233 CCTGGTACACCTGGCATACCTTG No data
Right 929400201 2:41571239-41571261 TACCATGAGCACATGCACCCAGG No data
929400196_929400201 14 Left 929400196 2:41571202-41571224 CCTATGTCTCCTGGTACACCTGG No data
Right 929400201 2:41571239-41571261 TACCATGAGCACATGCACCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
929400201 Original CRISPR TACCATGAGCACATGCACCC AGG Intergenic
No off target data available for this crispr