ID: 929401010

View in Genome Browser
Species Human (GRCh38)
Location 2:41581729-41581751
Sequence TGTGATCTAATATCACCTAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
929401010_929401012 0 Left 929401010 2:41581729-41581751 CCTGTAGGTGATATTAGATCACA No data
Right 929401012 2:41581752-41581774 TCTCCAAGGCCCTCCTACATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
929401010 Original CRISPR TGTGATCTAATATCACCTAC AGG (reversed) Intergenic
No off target data available for this crispr