ID: 929403273

View in Genome Browser
Species Human (GRCh38)
Location 2:41610725-41610747
Sequence AAAACTGAAACTCAGGAGAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
929403271_929403273 9 Left 929403271 2:41610693-41610715 CCAGGGTTGATGATGGCAAAAAT No data
Right 929403273 2:41610725-41610747 AAAACTGAAACTCAGGAGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
929403273 Original CRISPR AAAACTGAAACTCAGGAGAC AGG Intergenic
No off target data available for this crispr