ID: 929403568

View in Genome Browser
Species Human (GRCh38)
Location 2:41613620-41613642
Sequence CGGTGATTAGGTAAGGAGGT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
929403558_929403568 30 Left 929403558 2:41613567-41613589 CCTAAAGAAAAATGAAGAGAAGG No data
Right 929403568 2:41613620-41613642 CGGTGATTAGGTAAGGAGGTAGG No data
929403563_929403568 6 Left 929403563 2:41613591-41613613 CCAAGTTGTTTAGGAGGTCAAAC No data
Right 929403568 2:41613620-41613642 CGGTGATTAGGTAAGGAGGTAGG No data
929403562_929403568 7 Left 929403562 2:41613590-41613612 CCCAAGTTGTTTAGGAGGTCAAA No data
Right 929403568 2:41613620-41613642 CGGTGATTAGGTAAGGAGGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
929403568 Original CRISPR CGGTGATTAGGTAAGGAGGT AGG Intergenic
No off target data available for this crispr