ID: 929407216

View in Genome Browser
Species Human (GRCh38)
Location 2:41656551-41656573
Sequence CTGCTGTCCTTGCGATAAAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
929407205_929407216 26 Left 929407205 2:41656502-41656524 CCCAGTGTTGGAGGTGTTTGGGT No data
Right 929407216 2:41656551-41656573 CTGCTGTCCTTGCGATAAAGAGG No data
929407203_929407216 27 Left 929407203 2:41656501-41656523 CCCCAGTGTTGGAGGTGTTTGGG No data
Right 929407216 2:41656551-41656573 CTGCTGTCCTTGCGATAAAGAGG No data
929407206_929407216 25 Left 929407206 2:41656503-41656525 CCAGTGTTGGAGGTGTTTGGGTC No data
Right 929407216 2:41656551-41656573 CTGCTGTCCTTGCGATAAAGAGG No data
929407213_929407216 -10 Left 929407213 2:41656538-41656560 CCCTCATGGCTTCCTGCTGTCCT No data
Right 929407216 2:41656551-41656573 CTGCTGTCCTTGCGATAAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
929407216 Original CRISPR CTGCTGTCCTTGCGATAAAG AGG Intergenic
No off target data available for this crispr