ID: 929413388

View in Genome Browser
Species Human (GRCh38)
Location 2:41722531-41722553
Sequence CTCAGAATGAGGGGTTTCCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
929413383_929413388 1 Left 929413383 2:41722507-41722529 CCCTGGGTTTTACAACTAGGAGA No data
Right 929413388 2:41722531-41722553 CTCAGAATGAGGGGTTTCCCTGG No data
929413384_929413388 0 Left 929413384 2:41722508-41722530 CCTGGGTTTTACAACTAGGAGAT No data
Right 929413388 2:41722531-41722553 CTCAGAATGAGGGGTTTCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
929413388 Original CRISPR CTCAGAATGAGGGGTTTCCC TGG Intergenic
No off target data available for this crispr