ID: 929417343

View in Genome Browser
Species Human (GRCh38)
Location 2:41756904-41756926
Sequence GGGACACTGAACTACAGTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
929417343_929417348 -2 Left 929417343 2:41756904-41756926 CCTGCACTGTAGTTCAGTGTCCC No data
Right 929417348 2:41756925-41756947 CCCAAACTTTTTGACACCAGGGG No data
929417343_929417344 -4 Left 929417343 2:41756904-41756926 CCTGCACTGTAGTTCAGTGTCCC No data
Right 929417344 2:41756923-41756945 TCCCCAAACTTTTTGACACCAGG No data
929417343_929417346 -3 Left 929417343 2:41756904-41756926 CCTGCACTGTAGTTCAGTGTCCC No data
Right 929417346 2:41756924-41756946 CCCCAAACTTTTTGACACCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
929417343 Original CRISPR GGGACACTGAACTACAGTGC AGG (reversed) Intergenic
No off target data available for this crispr