ID: 929423722

View in Genome Browser
Species Human (GRCh38)
Location 2:41821442-41821464
Sequence TTTCCCAGTCAGTCACATCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
929423718_929423722 15 Left 929423718 2:41821404-41821426 CCTGGCTCCCTCACTGAACAATG No data
Right 929423722 2:41821442-41821464 TTTCCCAGTCAGTCACATCCTGG No data
929423720_929423722 7 Left 929423720 2:41821412-41821434 CCTCACTGAACAATGACTAGTCC No data
Right 929423722 2:41821442-41821464 TTTCCCAGTCAGTCACATCCTGG No data
929423719_929423722 8 Left 929423719 2:41821411-41821433 CCCTCACTGAACAATGACTAGTC No data
Right 929423722 2:41821442-41821464 TTTCCCAGTCAGTCACATCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
929423722 Original CRISPR TTTCCCAGTCAGTCACATCC TGG Intergenic
No off target data available for this crispr