ID: 929424678

View in Genome Browser
Species Human (GRCh38)
Location 2:41831986-41832008
Sequence CCAAATACACTCGTGTGCTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
929424673_929424678 28 Left 929424673 2:41831935-41831957 CCACTCTATGGGTCTCATTTTAA No data
Right 929424678 2:41831986-41832008 CCAAATACACTCGTGTGCTGAGG No data
929424675_929424678 -3 Left 929424675 2:41831966-41831988 CCCATTTAGAGGCTCTATTTCCA No data
Right 929424678 2:41831986-41832008 CCAAATACACTCGTGTGCTGAGG No data
929424676_929424678 -4 Left 929424676 2:41831967-41831989 CCATTTAGAGGCTCTATTTCCAA No data
Right 929424678 2:41831986-41832008 CCAAATACACTCGTGTGCTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
929424678 Original CRISPR CCAAATACACTCGTGTGCTG AGG Intergenic
No off target data available for this crispr