ID: 929428936

View in Genome Browser
Species Human (GRCh38)
Location 2:41870607-41870629
Sequence CTAAGCCAGAATCTTGGAAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
929428936_929428938 -1 Left 929428936 2:41870607-41870629 CCTTTTCCAAGATTCTGGCTTAG No data
Right 929428938 2:41870629-41870651 GCCAGTATTAGTTACAGTTCAGG No data
929428936_929428940 29 Left 929428936 2:41870607-41870629 CCTTTTCCAAGATTCTGGCTTAG No data
Right 929428940 2:41870659-41870681 ATGTCCTTCAAGAAGAGTTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
929428936 Original CRISPR CTAAGCCAGAATCTTGGAAA AGG (reversed) Intergenic
No off target data available for this crispr