ID: 929428937

View in Genome Browser
Species Human (GRCh38)
Location 2:41870613-41870635
Sequence TACTGGCTAAGCCAGAATCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
929428937_929428940 23 Left 929428937 2:41870613-41870635 CCAAGATTCTGGCTTAGCCAGTA No data
Right 929428940 2:41870659-41870681 ATGTCCTTCAAGAAGAGTTTAGG No data
929428937_929428938 -7 Left 929428937 2:41870613-41870635 CCAAGATTCTGGCTTAGCCAGTA No data
Right 929428938 2:41870629-41870651 GCCAGTATTAGTTACAGTTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
929428937 Original CRISPR TACTGGCTAAGCCAGAATCT TGG (reversed) Intergenic
No off target data available for this crispr