ID: 929428939

View in Genome Browser
Species Human (GRCh38)
Location 2:41870630-41870652
Sequence ACCTGAACTGTAACTAATAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
929428939_929428940 6 Left 929428939 2:41870630-41870652 CCAGTATTAGTTACAGTTCAGGT No data
Right 929428940 2:41870659-41870681 ATGTCCTTCAAGAAGAGTTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
929428939 Original CRISPR ACCTGAACTGTAACTAATAC TGG (reversed) Intergenic
No off target data available for this crispr