ID: 929428940

View in Genome Browser
Species Human (GRCh38)
Location 2:41870659-41870681
Sequence ATGTCCTTCAAGAAGAGTTT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
929428937_929428940 23 Left 929428937 2:41870613-41870635 CCAAGATTCTGGCTTAGCCAGTA No data
Right 929428940 2:41870659-41870681 ATGTCCTTCAAGAAGAGTTTAGG No data
929428939_929428940 6 Left 929428939 2:41870630-41870652 CCAGTATTAGTTACAGTTCAGGT No data
Right 929428940 2:41870659-41870681 ATGTCCTTCAAGAAGAGTTTAGG No data
929428936_929428940 29 Left 929428936 2:41870607-41870629 CCTTTTCCAAGATTCTGGCTTAG No data
Right 929428940 2:41870659-41870681 ATGTCCTTCAAGAAGAGTTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
929428940 Original CRISPR ATGTCCTTCAAGAAGAGTTT AGG Intergenic
No off target data available for this crispr