ID: 929431076

View in Genome Browser
Species Human (GRCh38)
Location 2:41887079-41887101
Sequence CAGTTGCCCTTTACATGATG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
929431076_929431079 -5 Left 929431076 2:41887079-41887101 CCTCATCATGTAAAGGGCAACTG No data
Right 929431079 2:41887097-41887119 AACTGGTTAGAGAAGTCTTAGGG No data
929431076_929431078 -6 Left 929431076 2:41887079-41887101 CCTCATCATGTAAAGGGCAACTG No data
Right 929431078 2:41887096-41887118 CAACTGGTTAGAGAAGTCTTAGG No data
929431076_929431080 -2 Left 929431076 2:41887079-41887101 CCTCATCATGTAAAGGGCAACTG No data
Right 929431080 2:41887100-41887122 TGGTTAGAGAAGTCTTAGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
929431076 Original CRISPR CAGTTGCCCTTTACATGATG AGG (reversed) Intergenic
No off target data available for this crispr