ID: 929431079

View in Genome Browser
Species Human (GRCh38)
Location 2:41887097-41887119
Sequence AACTGGTTAGAGAAGTCTTA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
929431073_929431079 12 Left 929431073 2:41887062-41887084 CCAGTCGAGATAACACACCTCAT No data
Right 929431079 2:41887097-41887119 AACTGGTTAGAGAAGTCTTAGGG No data
929431076_929431079 -5 Left 929431076 2:41887079-41887101 CCTCATCATGTAAAGGGCAACTG No data
Right 929431079 2:41887097-41887119 AACTGGTTAGAGAAGTCTTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
929431079 Original CRISPR AACTGGTTAGAGAAGTCTTA GGG Intergenic
No off target data available for this crispr