ID: 929431581

View in Genome Browser
Species Human (GRCh38)
Location 2:41892194-41892216
Sequence CAAGGCAGCCAATTTCAATT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
929431581_929431589 5 Left 929431581 2:41892194-41892216 CCAAATTGAAATTGGCTGCCTTG No data
Right 929431589 2:41892222-41892244 GAGGGAGAACTCCAAAAACATGG No data
929431581_929431591 28 Left 929431581 2:41892194-41892216 CCAAATTGAAATTGGCTGCCTTG No data
Right 929431591 2:41892245-41892267 TTTTCTAAGTACAATCTGTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
929431581 Original CRISPR CAAGGCAGCCAATTTCAATT TGG (reversed) Intergenic
No off target data available for this crispr