ID: 929434938

View in Genome Browser
Species Human (GRCh38)
Location 2:41921391-41921413
Sequence GCCCCCTACAAAATGTCCTA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
929434936_929434938 17 Left 929434936 2:41921351-41921373 CCTTCAGGTTTCGTCTTTCCTTC No data
Right 929434938 2:41921391-41921413 GCCCCCTACAAAATGTCCTATGG No data
929434935_929434938 18 Left 929434935 2:41921350-41921372 CCCTTCAGGTTTCGTCTTTCCTT No data
Right 929434938 2:41921391-41921413 GCCCCCTACAAAATGTCCTATGG No data
929434937_929434938 -1 Left 929434937 2:41921369-41921391 CCTTCTGTCATTCTACATCATAG No data
Right 929434938 2:41921391-41921413 GCCCCCTACAAAATGTCCTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
929434938 Original CRISPR GCCCCCTACAAAATGTCCTA TGG Intergenic
No off target data available for this crispr