ID: 929438349

View in Genome Browser
Species Human (GRCh38)
Location 2:41946210-41946232
Sequence ATGGAGGAGCAACATGAGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 256
Summary {0: 1, 1: 0, 2: 0, 3: 23, 4: 232}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
929438343_929438349 7 Left 929438343 2:41946180-41946202 CCAGGTGGGCAGCAAGGAAAAGG 0: 1
1: 0
2: 4
3: 32
4: 285
Right 929438349 2:41946210-41946232 ATGGAGGAGCAACATGAGCAGGG 0: 1
1: 0
2: 0
3: 23
4: 232

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
929438349 Original CRISPR ATGGAGGAGCAACATGAGCA GGG Intronic
900805900 1:4768293-4768315 GTGGAGGAAACACATGAGCATGG - Intronic
901389878 1:8937949-8937971 ATAGAGGAGCCAAATGAACAAGG - Intergenic
901907287 1:12424587-12424609 ATGAAGGAGCCAGGTGAGCAGGG + Intronic
902649147 1:17825455-17825477 CTGCAGGAGCAACATGGCCACGG - Intronic
903918212 1:26779995-26780017 AAGGAGGAGGAACAGGACCAAGG + Exonic
904347463 1:29882540-29882562 ATGGAGAAGAAACCAGAGCAGGG + Intergenic
904539759 1:31224869-31224891 ATGGAGGGGCAACCTGAGGGGGG + Intronic
905205825 1:36342359-36342381 CTGGAGGAGCCACATACGCAGGG + Intronic
906308089 1:44733880-44733902 AATGAGGAGCAACAGGATCAAGG - Intergenic
906582951 1:46951606-46951628 ATTGAGGACCTACATGTGCAGGG - Intergenic
907214783 1:52853022-52853044 ATGGAGAAGCTACATCAACAGGG + Intronic
909498312 1:76304516-76304538 CAGGAGGAGCAGCATGAACAAGG + Intronic
910107447 1:83646752-83646774 ATGGAGAATAAACATGAGTAGGG - Intergenic
911151906 1:94604246-94604268 ATTGATGAGCAGCATGAGCATGG + Intergenic
911941781 1:104056902-104056924 ATGGAAGAAGAACAGGAGCAGGG + Intergenic
914918314 1:151831553-151831575 CTGGAGGAGAAACAGGAGGAGGG - Intronic
915615838 1:157037530-157037552 CTAGAGGAGCAACACGAGCAAGG - Intronic
917494020 1:175523958-175523980 TAGGAGGAGCAGCATGGGCAAGG - Intronic
918378880 1:183935259-183935281 ATGGAGGAGCAACATAAAGCAGG - Intronic
919622324 1:199876758-199876780 ATCGAGAAGGAAAATGAGCAAGG + Intergenic
921887521 1:220321621-220321643 ATGGAGGAGGAAGAGGAGGAAGG + Intergenic
924481176 1:244435656-244435678 ATGGAGGAGGAAGAGGAGGATGG - Intronic
924953886 1:248909202-248909224 ATGGAGGAGCCACATGTGAGGGG + Intronic
1064737237 10:18394630-18394652 ATAGAGAAGCTACCTGAGCAAGG - Intronic
1066609345 10:37222656-37222678 ATGGAGGAACAGCATGAGGAAGG - Intronic
1070313072 10:75287702-75287724 ATGGAGCAGCAGAATGAGGAGGG - Intergenic
1071573421 10:86710163-86710185 AGGGCGGAGCATCATTAGCAAGG - Intronic
1071777572 10:88806341-88806363 CAGGAGGAGCAAAATGAGCAGGG - Intronic
1073339643 10:102735225-102735247 AGGGAGGAGCAACATGGAGAGGG - Intronic
1074508920 10:114095486-114095508 TTAGAGGAGGAACATGAGAAGGG + Intergenic
1074676688 10:115859358-115859380 AGGGAGGGGTAATATGAGCAGGG - Intronic
1075561263 10:123470193-123470215 ACTGAGGAGCAAATTGAGCAAGG + Intergenic
1076702206 10:132279637-132279659 ATGGAGGAGTGGCATGATCAGGG - Intronic
1081850445 11:46271897-46271919 AGGGAGAAGCCACAGGAGCAGGG - Intergenic
1082921979 11:58505409-58505431 AAGGAGGAGCAGGATGAGGAGGG + Intergenic
1083717902 11:64589548-64589570 CTGGAGGTCCAACATAAGCAAGG + Intergenic
1084164264 11:67367638-67367660 ATGGACGAGAAGCATGAGCGCGG + Intronic
1084851354 11:71943811-71943833 CAGGAGGAGCAGCATGTGCAAGG + Intronic
1086070853 11:82797410-82797432 ATGGAGGACCAAGGTCAGCAAGG + Intergenic
1086759950 11:90616208-90616230 ATGAAGAAGCAGCATGAACATGG - Intergenic
1087149229 11:94843679-94843701 ATGGAGGAGAAACATTAGGGAGG + Intronic
1088107506 11:106223465-106223487 GAGGAGGAATAACATGAGCAGGG - Intergenic
1089173189 11:116529780-116529802 GTGGACGTGCAACAAGAGCAAGG - Intergenic
1089775902 11:120835620-120835642 ATGGAGGAGAAACCAGACCAAGG - Intronic
1090150539 11:124379145-124379167 ATGGATGAGTAACAGGGGCAGGG - Intergenic
1090243597 11:125200649-125200671 GTGCAGGAGAAACATGGGCATGG - Intronic
1090893828 11:130951478-130951500 AAGGGGCATCAACATGAGCATGG - Intergenic
1091360926 11:134977975-134977997 CTGGAGGAGCAATCTGAGCCTGG + Intergenic
1092242893 12:6846327-6846349 ATGGAGGAGTGACTTGTGCAAGG - Intronic
1093035283 12:14326760-14326782 ATGAAAGAGCAGCATGAGCCAGG - Intergenic
1095980986 12:47974722-47974744 CTGGTGGAGCAGCAAGAGCAAGG - Exonic
1100201374 12:92301518-92301540 AAAGAGGAGTAACATGATCAGGG - Intergenic
1100957200 12:99922060-99922082 ATAGAGGAGGAAACTGAGCAGGG - Intronic
1101651051 12:106677358-106677380 ATGTGGGAGCAACATAAGCCTGG + Intronic
1102250728 12:111385614-111385636 AGGGAGGAGCTCCATGACCAGGG - Intergenic
1102626599 12:114240072-114240094 ATGGAGGTGCAGGATGAGCGGGG - Intergenic
1106651994 13:31701071-31701093 CAGTAGGAGCAACATGAGCAAGG - Intergenic
1109246884 13:59965784-59965806 ATGTAAAAGCAACATGAGTATGG + Intronic
1109741079 13:66556361-66556383 ATGGAACAGCTACATGAGGATGG - Intronic
1110863971 13:80374494-80374516 ATGGAGAAGAAACATGAACCGGG + Intergenic
1111390161 13:87583418-87583440 ATTGAGGAGGAAAATCAGCATGG + Intergenic
1111990210 13:95108839-95108861 ATGGAGGAGGAACAGGTGCCAGG - Intronic
1112620233 13:101047223-101047245 ATGGAGGGGGAACAGAAGCAGGG - Intergenic
1112788991 13:102982808-102982830 AAGGAGGAGGAAGATGAGGAGGG + Intergenic
1112930469 13:104730017-104730039 ACAGAGGAAGAACATGAGCAAGG + Intergenic
1114899344 14:27037402-27037424 ATGGAGCATAAACAAGAGCAGGG - Intergenic
1115771871 14:36672050-36672072 ATGGAAGATCCACATGAGAAAGG + Intronic
1116039953 14:39674003-39674025 ATGGAGTAGTAGGATGAGCATGG - Intergenic
1116654986 14:47641016-47641038 ATTGAGGAGCTACTTGAGTAGGG - Intronic
1116919301 14:50555951-50555973 ATGATGGAGGAAAATGAGCATGG + Intronic
1117348760 14:54860290-54860312 ATGGAGGAGAAACATTCTCAAGG + Intronic
1118666548 14:68076007-68076029 ACTGAGGAGTAACATGGGCAGGG + Intronic
1118825015 14:69372094-69372116 ATGGATGAGCAGGATGAGTAGGG + Intergenic
1119257365 14:73209791-73209813 AGAGAGGGACAACATGAGCAAGG + Intronic
1120545566 14:85807463-85807485 ATGGATGACCAAAGTGAGCAAGG - Intergenic
1120686514 14:87544049-87544071 ATGGAGGAGCTGCCTGAGAAGGG + Intergenic
1121201940 14:92124956-92124978 AAGGAGGTGGAACATGAGCTGGG + Intronic
1122387779 14:101360831-101360853 ATGGAGGGGGAACTTGAGCAAGG - Intergenic
1122804624 14:104250245-104250267 GTGGAGGGACCACATGAGCAAGG + Intergenic
1125301046 15:38253135-38253157 ATGGAGGAGCAACAGCAGGCGGG - Exonic
1125421210 15:39506547-39506569 ATGGAGGAGTCACAGGGGCATGG + Intergenic
1127262590 15:57337113-57337135 CTGGAGGAGCAGCATGAACATGG + Intergenic
1127734549 15:61829019-61829041 AGGGAGGAGCACCCTGACCAGGG + Intergenic
1131757102 15:95576779-95576801 ACAGAGAAGCATCATGAGCAAGG - Intergenic
1133975091 16:10594891-10594913 ATGGAGGAGGGGCATGTGCACGG - Intergenic
1135719693 16:24805115-24805137 ATGGAGGAGGCACTTGAGCACGG - Exonic
1136019340 16:27430094-27430116 CTGGAGCAGCAGCAGGAGCAAGG - Exonic
1138459233 16:57138210-57138232 ATGGAGGTGGAAGATGAGAAAGG - Intronic
1143302126 17:5918296-5918318 AAGGACCAGCACCATGAGCATGG - Intronic
1143399680 17:6636271-6636293 TGGGAGGAGGCACATGAGCAAGG + Intronic
1143692101 17:8577265-8577287 GTGAAGAAGCAACATGGGCAAGG + Exonic
1146164294 17:30575919-30575941 ATGGAAGGGGAACATGGGCAGGG - Intergenic
1148490665 17:48022051-48022073 AGGGAGCAACAACATAAGCAAGG - Intergenic
1150576252 17:66433474-66433496 ATGGAGTAGCTAAAGGAGCAGGG + Intronic
1150980168 17:70132524-70132546 CTGGAGGATCACCATGAGCACGG - Exonic
1151249236 17:72820816-72820838 AGGGAGGAGAAACATGTGGATGG + Intronic
1151874234 17:76857424-76857446 ATGCAGGTGCCACATGAGGAGGG - Intergenic
1152088085 17:78232281-78232303 CTGGCGGGGCAACACGAGCAGGG - Intronic
1152340306 17:79720744-79720766 ATGGAGCAGGAGCAGGAGCAGGG - Intergenic
1156708195 18:39909542-39909564 ATGGAGGAGCAGCTTGAGAAAGG - Intergenic
1158591762 18:58784470-58784492 ATGGAAGAGCAAGAAGAGCAGGG + Intergenic
1158818494 18:61131059-61131081 GAGGAGGAGGAACATGACCAGGG + Intergenic
1159075878 18:63681485-63681507 GTGGCTGAGCACCATGAGCATGG - Intronic
1160116090 18:76080986-76081008 CTGGAGAAGCAACATGAGTTGGG + Intergenic
1160384511 18:78486658-78486680 ATGGATGACCAACAGGAGCAAGG + Intergenic
1162828526 19:13269537-13269559 ATGCAGGAGCAGCTTGATCAAGG + Intronic
1165435536 19:35792836-35792858 ATGGAGGATCACTACGAGCATGG + Intergenic
1165717592 19:38056377-38056399 ATGGAGGAAAAACAGGTGCAAGG - Intronic
1166108860 19:40610869-40610891 ATGGAGAAGCAGAATGAGGAGGG + Intronic
1166831874 19:45644143-45644165 ATCGAGCATCAACATGAGCCGGG - Intronic
925619415 2:5776478-5776500 ATGGAGGAGTCAGATGAGCTTGG + Intergenic
925703215 2:6659506-6659528 ACGGAGCAGTCACATGAGCAAGG + Intergenic
925951652 2:8919040-8919062 ATGGAGGAACCTCAAGAGCACGG - Intronic
926434708 2:12826092-12826114 TTGGAGTAGCAGCATGAACAAGG - Intergenic
927756792 2:25714876-25714898 TGGGAGGAGCAACATCTGCAAGG + Intergenic
929438349 2:41946210-41946232 ATGGAGGAGCAACATGAGCAGGG + Intronic
929893671 2:45939391-45939413 ATGAAAGAGCAACATGCGGAAGG - Intronic
930624306 2:53679469-53679491 ATGGAGAAGAAAGATGAGGATGG - Intronic
930851938 2:55970894-55970916 ATGGAGGAACAACTTGGGAATGG - Intergenic
931229242 2:60360169-60360191 ATGGAGGGGCAAGATGAGCCTGG + Intergenic
932109991 2:68989991-68990013 TTGGAGGAAGAATATGAGCAAGG - Intergenic
932989946 2:76774608-76774630 AAGGAGGAGGAACATGAGGAAGG + Intronic
937530359 2:122820188-122820210 ATGGAGGAACAATTTAAGCAAGG - Intergenic
937756698 2:125547816-125547838 ATGGAAAACCAACAAGAGCAAGG + Intergenic
939335290 2:140819083-140819105 ATGGTGGAGCAGCAAGGGCAAGG - Intronic
941775087 2:169384682-169384704 ATTGAGGAGCCAAATGAGTAAGG - Intergenic
945271530 2:207945291-207945313 ATAGAGGAGAAAAGTGAGCACGG - Intronic
946235511 2:218322506-218322528 CTGGAGGAGCAACATGACCTAGG - Intronic
946369603 2:219272632-219272654 ATGGAGCTGCAACAAGAGCCCGG + Intronic
947343440 2:229164781-229164803 AGGGAGGAGAAACACAAGCAGGG + Intronic
947841413 2:233210151-233210173 ATGGAGGAAGAGCATGAGCTGGG - Intronic
948306816 2:236954585-236954607 CTGGAGGAGAAACATGAAAAGGG + Intergenic
948331740 2:237173024-237173046 ATGGATGAACAACATGTCCACGG - Intergenic
1170962241 20:21035768-21035790 ATTGAGGAGCAAAAAGAGGAAGG + Intergenic
1170979339 20:21196333-21196355 AAGGAGGAGGAACGTGAGCCAGG - Intronic
1171517785 20:25751213-25751235 CTGGAGGATCAACATTATCATGG + Intergenic
1172520502 20:35562621-35562643 ATGGAGGTCCAAGATGAGCAGGG + Intergenic
1172784071 20:37454458-37454480 TGGCTGGAGCAACATGAGCAAGG - Intergenic
1173040567 20:39458570-39458592 AAGGAGGAGCAGCATGAGAGGGG + Intergenic
1174034520 20:47660162-47660184 ATGGAGGAGTAAGGTGAACAAGG - Intronic
1174595541 20:51680462-51680484 ATGGAGGAGGACCAGGAGCTTGG - Intronic
1174658982 20:52194152-52194174 AGGGAGGAGCAACAACAGCAAGG - Intronic
1174768148 20:53273036-53273058 AGGCAGGAGAAACAGGAGCAGGG + Intronic
1174983160 20:55420178-55420200 TTAGAGGAGAAAAATGAGCAAGG - Intergenic
1175457697 20:59127713-59127735 ATGGAGGAGCTTCAAGGGCAGGG + Intergenic
1178149658 21:29779712-29779734 ATGGCTGAGCAACATTAGCTAGG + Intronic
1179063063 21:37997608-37997630 ATGGAGGAGCTATATGAGCCAGG - Intronic
1179287643 21:39991733-39991755 ATGGAGGGGCAACATAGGCTGGG - Intergenic
1180015388 21:45079047-45079069 CTGGAGGAGGAATATCAGCAAGG + Intronic
1181624715 22:24115471-24115493 AGAGAGGAGCAACATGGCCATGG - Intronic
1181913778 22:26262719-26262741 AAGGAGGACCAGCATGTGCATGG + Intronic
1181914450 22:26268398-26268420 AAGGAGGGGCAACATGACCAAGG + Intronic
1182022805 22:27095281-27095303 ATGGAGGGAGAACTTGAGCAGGG + Intergenic
1182086724 22:27566004-27566026 ATGGATGAGCATCATCAGCTGGG - Intergenic
1182576760 22:31278250-31278272 AGGCAGGTGGAACATGAGCAGGG - Intronic
1182985470 22:34712262-34712284 TTGGGGGAGCATCATGAGAAAGG - Intergenic
1184186962 22:42871430-42871452 ATGGAGGACGAGGATGAGCAGGG - Exonic
949209914 3:1485574-1485596 GTGGAGGAGCTACAGGAGAAGGG - Intergenic
951281714 3:20758373-20758395 ATGCAGGAGCAAGATCAGAAGGG + Intergenic
953295541 3:41711858-41711880 ATGGAGGACCAAAAGAAGCATGG + Intronic
954419618 3:50411857-50411879 GGGGAGGAGCAACATGCCCAGGG + Intronic
955834451 3:63039319-63039341 ATGGAGGAGAAACATCAGTCAGG - Intergenic
956508215 3:69965203-69965225 CCGGAGGAGCAGTATGAGCATGG + Exonic
958466134 3:94461271-94461293 ATGGAGGAGAAACTTCAACAGGG - Intergenic
959659108 3:108845442-108845464 ATGGAGAAAAATCATGAGCAGGG + Intronic
960603286 3:119479262-119479284 ATGGATGAGCAAAATGAGAAGGG - Intronic
960659287 3:120040870-120040892 GAGGAGGAGTAACATGAGTAGGG - Intronic
961661680 3:128472168-128472190 ATGGAGGAGCAGCCCCAGCATGG + Intergenic
962649881 3:137477804-137477826 ATGAAGCAGCAATATTAGCAGGG + Intergenic
962938178 3:140100875-140100897 ATGAGGGCACAACATGAGCATGG - Intronic
963127265 3:141827451-141827473 ATAGAGAAGGGACATGAGCAGGG + Intergenic
963871760 3:150423524-150423546 TTGGAGGAGGAACAAGACCAAGG + Intronic
965329102 3:167347843-167347865 ATAAAGGAGTAACATGAACAAGG + Intronic
967054055 3:185812519-185812541 ATGTAGGAGTAACAAGGGCAGGG + Intronic
968471676 4:785537-785559 ATGGAGGAGAAACAGGGGCTCGG + Exonic
970828286 4:20305112-20305134 ATGGCATAGCATCATGAGCATGG - Intronic
971355282 4:25889811-25889833 ATCAAGGAGCACCATGTGCAGGG - Intronic
973885730 4:55319091-55319113 ATGGAGGGGCAACTTTATCAGGG - Intergenic
973966670 4:56170088-56170110 ATGGAGGAGGAAGAGGAGGAAGG - Intergenic
975723287 4:77268744-77268766 ATGGAGGAGGGAGGTGAGCAGGG + Intronic
976364093 4:84213878-84213900 ATGAGGGAGCCACATGAGGAGGG - Intergenic
977052963 4:92152853-92152875 ATGGAGGGGCAATATATGCAGGG - Intergenic
977373839 4:96174350-96174372 AGGGAGGAGAAAAATGAGGAGGG - Intergenic
977691013 4:99910987-99911009 ATGAAAGAGCAACATGAGAGTGG - Intronic
977938020 4:102827778-102827800 AGGGAGGAGGATCATGAGCTGGG + Intronic
978408370 4:108403387-108403409 ATGGAGCAGCAACATGTAGAGGG - Intergenic
978487807 4:109276012-109276034 ATGGAGGAGAAGAGTGAGCAGGG - Intronic
981036725 4:140177125-140177147 AAGTAGTAGGAACATGAGCAAGG - Intergenic
981455126 4:144944846-144944868 ATGGAGGATCATCATGAGGCAGG - Intergenic
981948974 4:150383096-150383118 ATGGATGATTAACATTAGCAAGG + Intronic
983547498 4:168979102-168979124 AAGGAGGAGTAACAGGAGGAGGG - Intronic
984732385 4:183079832-183079854 ATGGAGAAGCAGCAGGAGCCAGG + Intergenic
985950780 5:3220113-3220135 ATGGAGGAGGGAGAGGAGCAGGG - Intergenic
985965065 5:3333263-3333285 ATGGAGGAGCAGGACGTGCATGG - Intergenic
986806134 5:11310696-11310718 AGGGAGGAGGAACATGAGAGAGG - Intronic
988617890 5:32793129-32793151 GAGGAGGAGGAAGATGAGCAGGG + Intergenic
990978515 5:61580205-61580227 ATGATGGAGCATGATGAGCAAGG + Intergenic
993314827 5:86388968-86388990 ATGGAGAAGCAACAAGCTCAGGG - Intergenic
993332189 5:86614733-86614755 ATGGAGAAGCCACATTACCAGGG - Intergenic
995978530 5:118073051-118073073 ATGGTGGAGCAATGTGAGAAAGG + Intergenic
997674415 5:135702014-135702036 ATGGATGAGAAAGATGAGCCTGG + Intergenic
999521706 5:152357649-152357671 ATGGAGGACCAACATGATATGGG + Intergenic
999878353 5:155833732-155833754 ATGCAGGGGCAACATGAGGGGGG - Intergenic
1000377925 5:160601328-160601350 ATGGAAGAGAAACATTAGCCAGG - Intronic
1000872910 5:166599690-166599712 ATGAAGGAAGATCATGAGCAAGG - Intergenic
1002398394 5:178976017-178976039 ATGGAGGAGTAGGGTGAGCAGGG - Intergenic
1003664229 6:8094776-8094798 AAGGAGGAGGAAGAAGAGCACGG - Intronic
1003822762 6:9918284-9918306 ATGGAGGAGCAGCATGTGGTGGG - Intronic
1003989279 6:11469859-11469881 AAGGAGCAAAAACATGAGCATGG + Intergenic
1005377582 6:25199726-25199748 AAGGAGAAGGCACATGAGCAAGG - Intergenic
1005812587 6:29528815-29528837 CTGGAGGCTCAAAATGAGCAGGG - Intergenic
1007618487 6:43196803-43196825 ATTGAGAAGCATCATGAGGATGG - Exonic
1011969995 6:93211096-93211118 ATGGAGCAGGAACATAAACATGG + Intergenic
1012510994 6:100001665-100001687 ACGGGGAAGCATCATGAGCATGG - Intergenic
1014648522 6:124006229-124006251 AAGGAAAAGCAACAAGAGCAAGG + Intronic
1015282516 6:131448936-131448958 ATGGTGGAGCACCATGCTCAGGG - Intergenic
1018540056 6:164869721-164869743 ATGGTGGAGCTACATGAAAAAGG + Intergenic
1019446935 7:1076259-1076281 AGGGAGGAGCACCATGAGGGAGG + Intronic
1020142251 7:5618936-5618958 ATAGAGGAGGAACAGGAACAAGG + Intergenic
1024605356 7:51018438-51018460 ATGGAGGAGCATCAGGAAAAGGG - Intronic
1024708250 7:51985478-51985500 ACTGAGGAGCAACATGGACATGG - Intergenic
1026095670 7:67344610-67344632 CTGGAGATGCAGCATGAGCAAGG - Intergenic
1027341783 7:77216470-77216492 ATGGTTGAGAAACTTGAGCAAGG - Intronic
1027744478 7:82056335-82056357 TTGGAGAAGCAACATGAGGATGG + Intronic
1028157254 7:87445102-87445124 GTGGAAGAGCAACATTTGCAAGG + Intronic
1031005641 7:116467922-116467944 AGTGAGGAGCAAAATTAGCAAGG - Intronic
1032576375 7:133059411-133059433 ATGGAGGAGGAAAGTGAGGAGGG + Intronic
1034294951 7:149964014-149964036 ACAGAGGAGCAACATGAGCCAGG + Intergenic
1034811110 7:154132932-154132954 ACAGAGGAGCAACATGAGCCAGG - Intronic
1037113454 8:15194698-15194720 ATGGAGGAGGACCATAAGCCAGG + Intronic
1037187582 8:16082345-16082367 ATGCAGGAGCAAAAGCAGCACGG + Intergenic
1041318337 8:56587621-56587643 TTGGAGAACCAACATGAGAAAGG + Intergenic
1046181611 8:110656183-110656205 ATGCAGGAGTAAGAGGAGCAGGG - Intergenic
1048017815 8:130513177-130513199 TTGGAGGAGCAACAAGTGTATGG + Intergenic
1048079187 8:131106447-131106469 ATGGAGAAGCAATAAGAGAAGGG - Intergenic
1049763278 8:144340361-144340383 TTGGAGGACCCACAGGAGCAAGG + Intergenic
1049954797 9:682646-682668 AAGGAGGAGAAAAATGACCAGGG - Intronic
1050805305 9:9670184-9670206 ATGTAGAAGCAACAAGACCAGGG + Intronic
1059773804 9:117454372-117454394 ATGGAGGAATAAAAAGAGCAGGG - Intergenic
1059885104 9:118736923-118736945 ATGGAGGAGAAATGTGAGCTTGG + Intergenic
1060746077 9:126131764-126131786 AGGGAGGTGCAACCTCAGCAGGG + Intergenic
1061291581 9:129653479-129653501 ATGTAGGAGCAAGAAGATCAGGG - Intergenic
1061450451 9:130664533-130664555 ATGGAGAAGGAACCAGAGCAGGG - Intergenic
1062606758 9:137351988-137352010 CTGGAGGAGCATCAGGGGCATGG - Intronic
1186855826 X:13625216-13625238 ATGGAGGTGCAGGAGGAGCAGGG - Intronic
1187371972 X:18716854-18716876 ATTGAGGAGGAAAATGAGGACGG - Intronic
1188634866 X:32417231-32417253 ATGGTGGAGCAACAAAGGCAGGG - Intronic
1190277227 X:48906617-48906639 ATGGGGGAGTCACAGGAGCAAGG - Intronic
1192072669 X:67957752-67957774 ATGGAGGAGAATAATGAGCCAGG - Intergenic
1193647808 X:84089745-84089767 ATGGAGGAGAAAGAATAGCAGGG - Intronic
1195656000 X:107332150-107332172 ATGGAGGAGCAATCTGTTCAGGG + Intergenic
1196514626 X:116555011-116555033 AGGAAGCAGCAACATGATCATGG - Intergenic
1198047862 X:132920533-132920555 ACGTAAAAGCAACATGAGCAAGG + Intronic
1198767210 X:140091743-140091765 ATGGAGGAGCAGCAGAAGGAGGG + Intergenic
1199529739 X:148832788-148832810 ATGGACAAGCAACTTGACCAGGG + Intronic
1200121917 X:153795106-153795128 CTGGAGGAGCCACATAAGCTAGG + Intronic