ID: 929441474

View in Genome Browser
Species Human (GRCh38)
Location 2:41968594-41968616
Sequence TGCTACCCCCTCTTCCCTCT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
929441472_929441474 12 Left 929441472 2:41968559-41968581 CCTTTGAAATCTCAGGACAAAAT No data
Right 929441474 2:41968594-41968616 TGCTACCCCCTCTTCCCTCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
929441474 Original CRISPR TGCTACCCCCTCTTCCCTCT AGG Intergenic
No off target data available for this crispr