ID: 929442404

View in Genome Browser
Species Human (GRCh38)
Location 2:41974240-41974262
Sequence ATGACCAACTGGAAGAGTGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
929442397_929442404 10 Left 929442397 2:41974207-41974229 CCAAGACAGGGCAGGGAGAGGAG No data
Right 929442404 2:41974240-41974262 ATGACCAACTGGAAGAGTGAGGG No data
929442394_929442404 17 Left 929442394 2:41974200-41974222 CCGGAAGCCAAGACAGGGCAGGG No data
Right 929442404 2:41974240-41974262 ATGACCAACTGGAAGAGTGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
929442404 Original CRISPR ATGACCAACTGGAAGAGTGA GGG Intergenic
No off target data available for this crispr