ID: 929446779

View in Genome Browser
Species Human (GRCh38)
Location 2:42008423-42008445
Sequence TGCTATGGCAAGAAAGTGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
929446777_929446779 -2 Left 929446777 2:42008402-42008424 CCAAGGGCAGACAAAAGCAAATG No data
Right 929446779 2:42008423-42008445 TGCTATGGCAAGAAAGTGCCAGG No data
929446776_929446779 -1 Left 929446776 2:42008401-42008423 CCCAAGGGCAGACAAAAGCAAAT No data
Right 929446779 2:42008423-42008445 TGCTATGGCAAGAAAGTGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
929446779 Original CRISPR TGCTATGGCAAGAAAGTGCC AGG Intergenic
No off target data available for this crispr