ID: 929449440

View in Genome Browser
Species Human (GRCh38)
Location 2:42027034-42027056
Sequence GCCCCTGAGTGAGGTCTTCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
929449440_929449446 17 Left 929449440 2:42027034-42027056 CCTAGAAGACCTCACTCAGGGGC No data
Right 929449446 2:42027074-42027096 TCCATGGACATCAGCAGGTCTGG No data
929449440_929449445 12 Left 929449440 2:42027034-42027056 CCTAGAAGACCTCACTCAGGGGC No data
Right 929449445 2:42027069-42027091 AAGAATCCATGGACATCAGCAGG No data
929449440_929449443 1 Left 929449440 2:42027034-42027056 CCTAGAAGACCTCACTCAGGGGC No data
Right 929449443 2:42027058-42027080 TGCTGGCCTGCAAGAATCCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
929449440 Original CRISPR GCCCCTGAGTGAGGTCTTCT AGG (reversed) Intergenic
No off target data available for this crispr