ID: 929449443

View in Genome Browser
Species Human (GRCh38)
Location 2:42027058-42027080
Sequence TGCTGGCCTGCAAGAATCCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
929449440_929449443 1 Left 929449440 2:42027034-42027056 CCTAGAAGACCTCACTCAGGGGC No data
Right 929449443 2:42027058-42027080 TGCTGGCCTGCAAGAATCCATGG No data
929449435_929449443 11 Left 929449435 2:42027024-42027046 CCTCCTTCATCCTAGAAGACCTC No data
Right 929449443 2:42027058-42027080 TGCTGGCCTGCAAGAATCCATGG No data
929449434_929449443 25 Left 929449434 2:42027010-42027032 CCACAGCAGGTCTACCTCCTTCA No data
Right 929449443 2:42027058-42027080 TGCTGGCCTGCAAGAATCCATGG No data
929449442_929449443 -8 Left 929449442 2:42027043-42027065 CCTCACTCAGGGGCATGCTGGCC No data
Right 929449443 2:42027058-42027080 TGCTGGCCTGCAAGAATCCATGG No data
929449436_929449443 8 Left 929449436 2:42027027-42027049 CCTTCATCCTAGAAGACCTCACT No data
Right 929449443 2:42027058-42027080 TGCTGGCCTGCAAGAATCCATGG No data
929449433_929449443 26 Left 929449433 2:42027009-42027031 CCCACAGCAGGTCTACCTCCTTC No data
Right 929449443 2:42027058-42027080 TGCTGGCCTGCAAGAATCCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
929449443 Original CRISPR TGCTGGCCTGCAAGAATCCA TGG Intergenic
No off target data available for this crispr