ID: 929449445

View in Genome Browser
Species Human (GRCh38)
Location 2:42027069-42027091
Sequence AAGAATCCATGGACATCAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
929449436_929449445 19 Left 929449436 2:42027027-42027049 CCTTCATCCTAGAAGACCTCACT No data
Right 929449445 2:42027069-42027091 AAGAATCCATGGACATCAGCAGG No data
929449442_929449445 3 Left 929449442 2:42027043-42027065 CCTCACTCAGGGGCATGCTGGCC No data
Right 929449445 2:42027069-42027091 AAGAATCCATGGACATCAGCAGG No data
929449435_929449445 22 Left 929449435 2:42027024-42027046 CCTCCTTCATCCTAGAAGACCTC No data
Right 929449445 2:42027069-42027091 AAGAATCCATGGACATCAGCAGG No data
929449440_929449445 12 Left 929449440 2:42027034-42027056 CCTAGAAGACCTCACTCAGGGGC No data
Right 929449445 2:42027069-42027091 AAGAATCCATGGACATCAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
929449445 Original CRISPR AAGAATCCATGGACATCAGC AGG Intergenic
No off target data available for this crispr