ID: 929450844

View in Genome Browser
Species Human (GRCh38)
Location 2:42035993-42036015
Sequence GTGAATAAAACGATGAATGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
929450844_929450846 16 Left 929450844 2:42035993-42036015 CCAGCATTCATCGTTTTATTCAC No data
Right 929450846 2:42036032-42036054 ATCATGACATTTCTTTTGATGGG No data
929450844_929450845 15 Left 929450844 2:42035993-42036015 CCAGCATTCATCGTTTTATTCAC No data
Right 929450845 2:42036031-42036053 CATCATGACATTTCTTTTGATGG No data
929450844_929450847 30 Left 929450844 2:42035993-42036015 CCAGCATTCATCGTTTTATTCAC No data
Right 929450847 2:42036046-42036068 TTTGATGGGACACCTAATCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
929450844 Original CRISPR GTGAATAAAACGATGAATGC TGG (reversed) Intergenic
No off target data available for this crispr