ID: 929452881

View in Genome Browser
Species Human (GRCh38)
Location 2:42048338-42048360
Sequence CCGGGCCGTCGCGGGGGCCG CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 554
Summary {0: 1, 1: 0, 2: 2, 3: 50, 4: 501}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
929452862_929452881 8 Left 929452862 2:42048307-42048329 CCAGTCCCCTGAGCCTTCGCCGG 0: 1
1: 0
2: 0
3: 10
4: 138
Right 929452881 2:42048338-42048360 CCGGGCCGTCGCGGGGGCCGCGG 0: 1
1: 0
2: 2
3: 50
4: 501
929452864_929452881 3 Left 929452864 2:42048312-42048334 CCCCTGAGCCTTCGCCGGCCCCG 0: 1
1: 0
2: 2
3: 18
4: 158
Right 929452881 2:42048338-42048360 CCGGGCCGTCGCGGGGGCCGCGG 0: 1
1: 0
2: 2
3: 50
4: 501
929452861_929452881 13 Left 929452861 2:42048302-42048324 CCAGGCCAGTCCCCTGAGCCTTC 0: 1
1: 0
2: 1
3: 25
4: 321
Right 929452881 2:42048338-42048360 CCGGGCCGTCGCGGGGGCCGCGG 0: 1
1: 0
2: 2
3: 50
4: 501
929452870_929452881 -5 Left 929452870 2:42048320-42048342 CCTTCGCCGGCCCCGGGTCCGGG 0: 1
1: 0
2: 3
3: 23
4: 240
Right 929452881 2:42048338-42048360 CCGGGCCGTCGCGGGGGCCGCGG 0: 1
1: 0
2: 2
3: 50
4: 501
929452865_929452881 2 Left 929452865 2:42048313-42048335 CCCTGAGCCTTCGCCGGCCCCGG 0: 1
1: 0
2: 2
3: 7
4: 99
Right 929452881 2:42048338-42048360 CCGGGCCGTCGCGGGGGCCGCGG 0: 1
1: 0
2: 2
3: 50
4: 501
929452867_929452881 1 Left 929452867 2:42048314-42048336 CCTGAGCCTTCGCCGGCCCCGGG 0: 1
1: 1
2: 1
3: 19
4: 215
Right 929452881 2:42048338-42048360 CCGGGCCGTCGCGGGGGCCGCGG 0: 1
1: 0
2: 2
3: 50
4: 501
929452859_929452881 22 Left 929452859 2:42048293-42048315 CCTCCGAGGCCAGGCCAGTCCCC 0: 1
1: 0
2: 3
3: 57
4: 439
Right 929452881 2:42048338-42048360 CCGGGCCGTCGCGGGGGCCGCGG 0: 1
1: 0
2: 2
3: 50
4: 501
929452860_929452881 19 Left 929452860 2:42048296-42048318 CCGAGGCCAGGCCAGTCCCCTGA 0: 1
1: 0
2: 5
3: 44
4: 390
Right 929452881 2:42048338-42048360 CCGGGCCGTCGCGGGGGCCGCGG 0: 1
1: 0
2: 2
3: 50
4: 501

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
929452881 Original CRISPR CCGGGCCGTCGCGGGGGCCG CGG Exonic
900174975 1:1287610-1287632 CCTGGCCGGTGCGGGGGCAGGGG + Intronic
900227605 1:1540379-1540401 CCGGGGGGGCGCCGGGGCCGGGG - Intronic
900349750 1:2228695-2228717 CGGGGCGGCGGCGGGGGCCGGGG + Exonic
900418781 1:2546726-2546748 CCGGGCCGCCGAGAGCGCCGCGG + Intergenic
900629328 1:3625287-3625309 CAGGGCCGGGGCGGGGGCCGAGG + Intronic
900787107 1:4655826-4655848 CGCGGCGGGCGCGGGGGCCGGGG + Intronic
901577166 1:10210457-10210479 CGTGTCCGTCGCGGGCGCCGGGG + Intergenic
901641192 1:10694026-10694048 CCGGGCGGGCGCCGAGGCCGCGG + Intronic
902451503 1:16499353-16499375 CGGGGCCGAGGCGGGGGCGGGGG + Intergenic
903069102 1:20717828-20717850 CGGGGCCGCGGCGGGGGGCGGGG + Exonic
903153284 1:21428204-21428226 CCGGGCCGGAGCGCGGGCGGCGG + Intergenic
903263287 1:22142683-22142705 TCGGGCCGTGGCGGCGGCAGCGG + Intronic
903349985 1:22711410-22711432 CCCGGCCGTGGCGGGGGGCGGGG + Intronic
904500120 1:30908526-30908548 CGGGGCCGGCGCCGGGGCCGGGG - Exonic
904563340 1:31413163-31413185 CCGGGGCGGGGCCGGGGCCGGGG + Intronic
904782966 1:32964467-32964489 CTGGGCCGCGGCAGGGGCCGGGG + Exonic
906614568 1:47225568-47225590 CGAGGCGGGCGCGGGGGCCGGGG + Exonic
908473810 1:64470108-64470130 CTGGGCCGCCGCGGCGGCTGCGG - Intergenic
908738927 1:67307742-67307764 TCGGGCCGGGGCGGGGGTCGGGG - Exonic
911208735 1:95117905-95117927 CCCGGGCGGCGCGGGGGCCGCGG - Exonic
914758461 1:150579766-150579788 CCGGGGCGGGGCCGGGGCCGGGG + Intergenic
914758464 1:150579772-150579794 CGGGGCCGGGGCCGGGGCCGGGG + Intergenic
914758468 1:150579778-150579800 CGGGGCCGGGGCCGGGGCCGGGG + Intergenic
915572347 1:156751446-156751468 CCGGCCCGGCGCGGAGCCCGGGG - Intronic
918015985 1:180632524-180632546 CCGGGCCGGGGCCGGGGCCGGGG + Intronic
918388837 1:184037361-184037383 CCGGGCCGAGGCGGGCGGCGGGG + Exonic
921189824 1:212699608-212699630 CCGGCGCGCCGCGGGGGGCGAGG - Intronic
922505354 1:226122580-226122602 CACGGCCGGCGCGGGGGCAGAGG + Intergenic
922753500 1:228082057-228082079 CCGGGGTGAGGCGGGGGCCGTGG - Intergenic
923400781 1:233614079-233614101 CCGGGCGGGGGCGGGGGCGGCGG + Exonic
923631150 1:235650098-235650120 CCGGGCTGGGGCGGGGGCGGGGG - Intronic
924302360 1:242652345-242652367 CGGGGCTGTTGCAGGGGCCGTGG - Intergenic
924835133 1:247639711-247639733 CTGGGCGGACGCTGGGGCCGCGG + Intergenic
1062874012 10:931285-931307 CTGGGCCGGGGCCGGGGCCGGGG - Intronic
1062874016 10:931291-931313 CCGGGCCTGGGCCGGGGCCGGGG - Intronic
1067445104 10:46337044-46337066 CGGGGCCGGGGCCGGGGCCGGGG + Intergenic
1067502319 10:46816336-46816358 CGGGGCCGGGGCCGGGGCCGGGG + Intergenic
1067592268 10:47523684-47523706 CGGGGCCGGGGCCGGGGCCGGGG - Intronic
1069942404 10:71964559-71964581 CCGCGCGGGCGCCGGGGCCGCGG + Exonic
1070752779 10:78973858-78973880 CAGGGCCGGGGCTGGGGCCGGGG + Intergenic
1071301138 10:84256936-84256958 CGGGGCCCTCCCGGGAGCCGAGG - Intronic
1072784063 10:98268393-98268415 CCGGGAAGTCCCGGGGGGCGGGG + Intergenic
1073099626 10:100999847-100999869 CAGGGCCGGGGCCGGGGCCGGGG + Exonic
1073325545 10:102642596-102642618 CCGGGCCGTGGCGGGGGCCCCGG + Intergenic
1074772429 10:116742626-116742648 GCGGGCCGGGGCGGGGCCCGGGG - Intergenic
1075871238 10:125773858-125773880 CCTGGCCGCCCCCGGGGCCGCGG - Exonic
1076372300 10:129963588-129963610 CCGGGCCGGGGCCGGGGCCAGGG + Intronic
1076554345 10:131311922-131311944 CCGGGCGGCCGCGGAGGACGTGG + Intergenic
1076722215 10:132397580-132397602 GCGGGCCGGGGCGGGGGGCGCGG + Intronic
1076857586 10:133124830-133124852 CGGGGCCGGGGCCGGGGCCGGGG - Intronic
1076857590 10:133124836-133124858 CGGGGCCGGGGCCGGGGCCGGGG - Intronic
1077008521 11:369988-370010 CGGGGGCGGCGCGGGGGGCGCGG + Intronic
1077043741 11:535461-535483 CCGGGGCGGGGCGGGGGCGGGGG + Exonic
1077121500 11:910938-910960 CGGGGCCGGGGCCGGGGCCGGGG + Intronic
1077121504 11:910944-910966 CGGGGCCGGGGCCGGGGCCGGGG + Intronic
1077250069 11:1557023-1557045 CGGGGCCGCCGGCGGGGCCGTGG + Exonic
1077360420 11:2138188-2138210 CCGGGCCGGGGCCGGGGCTGGGG - Intronic
1077364622 11:2156517-2156539 CCGGGCACTCCCGGGGGCTGTGG - Intronic
1077495484 11:2884848-2884870 CGGGGCCGGGGCGGGGGCCGGGG + Exonic
1077495495 11:2884866-2884888 CGGGGCCGGGGCCGGGGCCGGGG + Exonic
1077495503 11:2884878-2884900 CGGGGCCGGGGCTGGGGCCGGGG + Exonic
1078175025 11:8964039-8964061 CCGGGCAGTCGGGAGGGGCGGGG + Intronic
1078514103 11:12008508-12008530 CGGAGCGGGCGCGGGGGCCGTGG + Exonic
1080283619 11:30585465-30585487 TCGGGCCGCCGCGGGAGCCCGGG + Intronic
1080387315 11:31817765-31817787 CCGGCCCGGCTCGGGGCCCGCGG - Intronic
1080503689 11:32892916-32892938 CCGGGCCGCGGCGGGCGGCGAGG - Intergenic
1080588334 11:33700499-33700521 CCGGGTGGTGGCGGGGGCGGGGG + Exonic
1080606640 11:33869634-33869656 CGCGGCCGAGGCGGGGGCCGGGG + Intronic
1080836263 11:35943959-35943981 CCGGGCCGGGGCCGGGCCCGGGG + Intronic
1081636782 11:44727061-44727083 CGGGGCCGGGGCTGGGGCCGGGG - Intronic
1081636790 11:44727073-44727095 CGGGGCCGGGGCCGGGGCCGGGG - Intronic
1081636794 11:44727079-44727101 CGGGGCCGGGGCCGGGGCCGGGG - Intronic
1081636798 11:44727085-44727107 CGGGGCCGGGGCCGGGGCCGGGG - Intronic
1081872955 11:46391586-46391608 CCGCGGCGGCGCGGGGGCGGGGG - Intergenic
1083886511 11:65575996-65576018 CCGGCGCGGGGCGGGGGCCGGGG - Intergenic
1084019472 11:66409216-66409238 CCGGCCCGGCGCGGGGCTCGCGG - Intergenic
1084212500 11:67630457-67630479 CCGGGCCGTGGCCGGGGGTGTGG + Intergenic
1084284068 11:68120695-68120717 CGGGGCCGGGGCGGAGGCCGGGG - Intronic
1084787667 11:71452995-71453017 CCGGGCCGGGGCCGGGGCCTGGG + Intergenic
1087188866 11:95231343-95231365 CCGGCCAATCGCAGGGGCCGAGG + Intronic
1088401063 11:109422945-109422967 CCGGGCCGCCGCGCGGGCTCCGG - Intronic
1088462113 11:110093102-110093124 CCGCGCCCTAGCGGCGGCCGCGG + Intergenic
1090780263 11:130001873-130001895 CCGGGCGGAGGCGGAGGCCGAGG - Intronic
1091229330 11:133977534-133977556 CAGGGCCCTCGGGGGGGCCCTGG + Intergenic
1091550281 12:1530963-1530985 CGGGGCCGTCCCCGGGGGCGAGG - Intronic
1091740749 12:2959232-2959254 CCGGGCCGGGGCGGGCGGCGGGG - Intergenic
1092246637 12:6867709-6867731 CCGGGCCGGGGCCGGGGCCGGGG + Intronic
1092365361 12:7872775-7872797 CCGCGCCGTCCCTGCGGCCGGGG - Intronic
1092861894 12:12725641-12725663 CCGGGCGGGCGCGGGGGCTGGGG - Intergenic
1093761902 12:22920341-22920363 CCTGGCCATCGCGAGGGCTGAGG + Intergenic
1094839791 12:34338071-34338093 CCGCGCATTCGCGGGGTCCGGGG + Intergenic
1095349197 12:41188903-41188925 CCGGGCGGCCGCTGGGGCCGCGG + Exonic
1096459459 12:51814315-51814337 CCAGTCCGGCGCGGGGACCGCGG + Intergenic
1096491415 12:52015020-52015042 GCGGGCCCTGGCGGGGGCGGAGG + Exonic
1096777628 12:53973814-53973836 CCGGGCTGAGGCGGGTGCCGAGG + Exonic
1096796749 12:54082581-54082603 CGGGGCCGGGGCCGGGGCCGGGG + Intergenic
1096796753 12:54082587-54082609 CGGGGCCGGGGCCGGGGCCGGGG + Intergenic
1097218272 12:57430845-57430867 CCGGGGCTTCCCCGGGGCCGAGG + Exonic
1099315533 12:81078247-81078269 CGGGGCGGTCTCGGGGGCCGGGG + Exonic
1100985710 12:100200015-100200037 CCGGGGCGTCGCGGGGGCAACGG - Intronic
1101302381 12:103495582-103495604 CTGGGCCGTCGCCGGGGCAACGG + Intronic
1102199420 12:111047126-111047148 CCGGGACCCAGCGGGGGCCGGGG - Intronic
1102853864 12:116277234-116277256 CCGGGCCGCCGCCGCCGCCGGGG + Exonic
1103363823 12:120368771-120368793 CCGGGGCGCCGGGGGGTCCGGGG + Intronic
1103562762 12:121800778-121800800 GGGGGCCGTTTCGGGGGCCGTGG - Intronic
1103941998 12:124506279-124506301 CAGGGCCGTGGGGAGGGCCGGGG - Intronic
1104568295 12:129903950-129903972 GCGGGCCGAGGCGGCGGCCGGGG - Intergenic
1104975138 12:132548827-132548849 CAGGGCCGTCCCTGAGGCCGGGG - Intronic
1105011944 12:132761911-132761933 CCGGGGCGGCGCGGGGGACACGG + Intergenic
1110450675 13:75635764-75635786 CCGGGCCCTCCCGGCGGCAGAGG - Intronic
1110450686 13:75635782-75635804 CCCGGCCGCCGCAGGGGGCGGGG + Intronic
1110860515 13:80341036-80341058 CCGGGCGGGCGCGGGGGCCTGGG + Intergenic
1111951708 13:94713238-94713260 CCGAGCCGGCGCAGGGGCGGAGG + Intergenic
1112344297 13:98577167-98577189 CCGGGCCGTGGGGGCGGGCGCGG - Intronic
1112505215 13:99971040-99971062 CATGGCCGCCGCGGGGGCCGTGG + Exonic
1112506617 13:99980007-99980029 CGGGGACGCCGCGGGGGGCGGGG + Intergenic
1113120244 13:106917584-106917606 CGGGGCCGGGGCCGGGGCCGGGG + Intergenic
1113120248 13:106917590-106917612 CGGGGCCGGGGCCGGGGCCGGGG + Intergenic
1113120252 13:106917596-106917618 CGGGGCCGGGGCCGGGGCCGGGG + Intergenic
1113120256 13:106917602-106917624 CGGGGCCGGGGCCGGGGCCGGGG + Intergenic
1113120260 13:106917608-106917630 CGGGGCCGGGGCCGGGGCCGGGG + Intergenic
1113120264 13:106917614-106917636 CGGGGCCGGGGCCGGGGCCGGGG + Intergenic
1113312034 13:109140998-109141020 CCGGGCGGGGGCGGGGGCGGGGG - Exonic
1113769233 13:112897983-112898005 CAGGGCCGGGGCCGGGGCCGGGG - Intronic
1113962324 13:114132774-114132796 CGGGGCGGGGGCGGGGGCCGAGG - Intergenic
1114554858 14:23556107-23556129 CCTGGCCACCGCGGGGGTCGCGG + Exonic
1115399243 14:32939140-32939162 CGGGGCCGTGGCCGTGGCCGTGG - Intronic
1115399248 14:32939158-32939180 GCGGGCGGTGGCCGGGGCCGGGG - Intronic
1115592084 14:34874462-34874484 CCGGGCCGTGTGCGGGGCCGCGG - Intronic
1115771461 14:36666794-36666816 CCGGCCCCTGGCGGGGGTCGAGG - Intronic
1117302230 14:54441154-54441176 CCGGGCCGCCACGGCCGCCGGGG - Intronic
1118289202 14:64504516-64504538 GGGGGCCGTCGCGGCGGCGGCGG - Intronic
1118607681 14:67515348-67515370 CCGCGGCGGCGCGGGGTCCGGGG + Intronic
1119286390 14:73458356-73458378 CCGGGCCGGGGCCGGGGCCAGGG - Intronic
1122265790 14:100546340-100546362 CCGGGGCGGGGCGAGGGCCGGGG - Intronic
1122265799 14:100546357-100546379 CCGGGGCGGGGCGAGGGCCGGGG - Intronic
1122265808 14:100546374-100546396 CCGGGGCGGGGCGAGGGCCGGGG - Intronic
1122265817 14:100546391-100546413 CCGGGGCGGGGCGAGGGCCGGGG - Intronic
1122265826 14:100546408-100546430 CCGGGGCGGGGCGAGGGCCGGGG - Intronic
1122265835 14:100546425-100546447 CCGGGGCGGGGCGAGGGCCGGGG - Intronic
1122265844 14:100546442-100546464 CCGGGGCGGGGCGAGGGCCGGGG - Intronic
1122265853 14:100546459-100546481 CCGGGGCGGGGCGAGGGCCGGGG - Intronic
1122399548 14:101458716-101458738 CCGGGCTGTCGCCGAGGCCGCGG - Intergenic
1122889026 14:104724174-104724196 CCGGGCCGGGGCAGGGGGCGGGG - Intronic
1122978558 14:105181083-105181105 CCGGGCCGCCGGCGGGGGCGCGG + Intronic
1122993333 14:105249099-105249121 GCGCGCGGGCGCGGGGGCCGCGG - Intronic
1123036646 14:105474509-105474531 CCGGGCCGTCCCCGGGGCGGCGG - Intronic
1123439936 15:20282834-20282856 CCGGGCGGACGGGTGGGCCGGGG + Intergenic
1124109484 15:26773051-26773073 CCGGGCCAGCGCGGCGGCGGCGG - Exonic
1124484614 15:30103608-30103630 CCAGGCGGTAGCGGGGGCAGTGG + Intergenic
1124497530 15:30195700-30195722 CCAGGCGGTAGCGGGGGCGGTGG + Intergenic
1124500443 15:30223296-30223318 CGGGGCCCGCGCCGGGGCCGGGG + Intergenic
1124500448 15:30223302-30223324 CCGCGCCGGGGCCGGGGCCGGGG + Intergenic
1124518967 15:30393630-30393652 CCAGGCGGTAGCGGGGGCAGTGG - Intronic
1124539689 15:30572616-30572638 CCAGGCGGTAGCGGGGGCAGTGG + Intergenic
1124584379 15:30991683-30991705 CCAGGCCGACGCGGGCGCCGGGG + Intergenic
1124743126 15:32315365-32315387 CCGCGCCGGGGCCGGGGCCGGGG - Intergenic
1124746059 15:32342991-32343013 CCAGGCGGTAGCGGGGGCGGTGG - Intergenic
1124758963 15:32434966-32434988 CCAGGCGGTAGCGGGGGCAGTGG - Intergenic
1124922299 15:34038874-34038896 CGGGGCCGTGGCCGTGGCCGGGG - Exonic
1125301024 15:38253073-38253095 CCGGGGGGGCGCGGGGGCAGCGG - Exonic
1125508787 15:40282026-40282048 CCGGGCCGCAGCGGCGGCGGCGG + Exonic
1125903641 15:43370976-43370998 CGGGGCCGGGGCCGGGGCCGGGG - Intronic
1125903645 15:43370982-43371004 CGGGGCCGGGGCCGGGGCCGGGG - Intronic
1126113264 15:45187679-45187701 CGGGGGCGGCGCGGGGGGCGCGG + Intronic
1128115426 15:65102163-65102185 CGGGGGCGACGCGGGGGCGGCGG + Exonic
1128153544 15:65377856-65377878 CGGGGCCGGCGCCGGGGCCGGGG + Exonic
1128161061 15:65423007-65423029 TGGGGCCGGCGCGGGGGCCAGGG + Exonic
1128972272 15:72118104-72118126 CCGGGGAGTCGCGCGGGGCGGGG - Intronic
1129273871 15:74433207-74433229 CCGGGCCGGGGCGGGGGCGGGGG + Intronic
1129675931 15:77632500-77632522 CCGAGCCGGAGCCGGGGCCGGGG + Intronic
1129710615 15:77818860-77818882 CCGGGCCGTCTGGCGGGCGGAGG - Intronic
1130508767 15:84570978-84571000 CCAGGCGGTAGCGGGGGCGGTGG - Intergenic
1131119809 15:89815003-89815025 CCGGGCCGTCGGAGGAGCGGAGG - Intronic
1132464744 16:72367-72389 CGGGGCCGGGGCCGGGGCCGGGG - Intronic
1132600013 16:769165-769187 CGGGGCCGGGGCCGGGGCCGGGG - Intergenic
1132600041 16:769213-769235 CGGGGCCGGGGCCGGGGCCGGGG - Intergenic
1132656694 16:1044478-1044500 CGGGGCCGCCTGGGGGGCCGAGG + Intergenic
1132687772 16:1169453-1169475 GGGGAACGTCGCGGGGGCCGCGG - Intronic
1132779355 16:1614313-1614335 CGGGGCCGGGGCCGGGGCCGGGG + Intronic
1132848054 16:2009732-2009754 CCGGACCATGGCGGCGGCCGGGG - Exonic
1132947177 16:2538094-2538116 CCGCGCCGACGCGGGGCCCATGG + Exonic
1132968543 16:2673426-2673448 CGGGGGCATCGCGGGGGGCGGGG - Intergenic
1132968552 16:2673444-2673466 GCGGGGCGTCGCGGGGGGCGGGG - Intergenic
1132987817 16:2777189-2777211 CCGGGCCGGGCCGGGGGCGGCGG - Intronic
1133220176 16:4316288-4316310 CCGGGCCGGGGCGGGGGGGGGGG + Intronic
1134163959 16:11915578-11915600 CCGGGCCCTTGCGGCGGCGGCGG - Exonic
1134163988 16:11915692-11915714 CCGGGCAGTGGCGGCGGCGGCGG - Exonic
1136141645 16:28292546-28292568 CCGGGCGGGCGCCGGGGCCGGGG + Exonic
1136237828 16:28925338-28925360 CGGGGCCGGGGCCGGGGCCGGGG - Exonic
1136237831 16:28925344-28925366 CCGGGGCGGGGCCGGGGCCGGGG - Exonic
1136365281 16:29806657-29806679 CCGGGGCTCAGCGGGGGCCGGGG - Exonic
1136396490 16:29995315-29995337 CCGGGCCGGAGCCTGGGCCGCGG - Exonic
1136414484 16:30095360-30095382 CCGCACCATGGCGGGGGCCGGGG + Exonic
1136428225 16:30183272-30183294 CCGGGCCGGGGCGGGCACCGAGG + Intronic
1136478355 16:30526711-30526733 TCGGGCGGGAGCGGGGGCCGGGG - Intronic
1136586715 16:31191022-31191044 CGGGGCCGCGGCGGGGACCGTGG + Exonic
1137057156 16:35751262-35751284 CCGGGCCCTGGTGGGGGCCCAGG - Intergenic
1137559249 16:49492476-49492498 CGGGGCCGGGGCCGGGGCCGGGG + Intronic
1137655323 16:50153839-50153861 CGGGGCCGGGGCCGGGGCCGAGG - Exonic
1138178708 16:54928780-54928802 CCGCGCGGGCGCGCGGGCCGCGG + Intergenic
1138360749 16:56425441-56425463 CCGGCCCGGCGCGGCGGCGGCGG - Exonic
1139582304 16:67880800-67880822 TCGGGCCCTGGCCGGGGCCGTGG - Exonic
1139965754 16:70744492-70744514 CAGGGCCATCGAGGGGGCCTGGG + Exonic
1140097078 16:71884219-71884241 CCTGGCCGGCGCGGGGGAGGGGG - Intronic
1141608834 16:85170131-85170153 CCAGGGCCTCGCGGGGGGCGCGG + Intergenic
1141630323 16:85284141-85284163 CCGGGCCTTCTCCTGGGCCGGGG - Intergenic
1141631693 16:85291477-85291499 CAGGGCTCACGCGGGGGCCGGGG - Intergenic
1141776009 16:86122838-86122860 CCAGGCCTTAGTGGGGGCCGTGG - Intergenic
1141972313 16:87492385-87492407 CCGGGCGGGCGCCGGGGCGGGGG + Intergenic
1142156422 16:88534610-88534632 CCTGGCCGGCCCGGGGGTCGAGG + Exonic
1142156459 16:88534700-88534722 CGAGGCCGTCCCGGGGGCCACGG - Exonic
1142643656 17:1299132-1299154 CCAGGCCATCGCGGGGGCCACGG - Exonic
1142808696 17:2385324-2385346 CTGGGCCGGCGAGGGGGCCGGGG - Exonic
1142848153 17:2691973-2691995 CGGGGGCGTGGCGGGGGCGGGGG - Intronic
1143119647 17:4598934-4598956 CAGGGCCGGGGCTGGGGCCGGGG - Intronic
1144586832 17:16492218-16492240 CCGGGCCGGGGCGGGGCCGGCGG - Intergenic
1144775304 17:17782154-17782176 CCGCGCAGGGGCGGGGGCCGCGG + Intronic
1144816696 17:18039910-18039932 CCGGGCCGGGCCGGGGCCCGAGG + Intronic
1145886449 17:28385307-28385329 CAGGGCCGTGGCTGGGGCTGGGG - Intronic
1146064166 17:29622267-29622289 CTTGGCCGTGGCGGGGGCAGGGG - Intronic
1146271366 17:31487961-31487983 CCGGGGCGGGGCGGGGGCGGGGG - Intronic
1147139720 17:38454151-38454173 CGGGGCCGGGGCCGGGGCCGGGG + Intronic
1147897446 17:43759872-43759894 CAGGGCCGGGGCGGGGGGCGGGG + Intergenic
1147957074 17:44142071-44142093 CCGGGGAGTCGCCGGGGCCTTGG - Exonic
1147967393 17:44200334-44200356 CCCGGCCGGCTCGGGGGCGGGGG + Intergenic
1148323707 17:46771707-46771729 GCGGCCCGGCGCCGGGGCCGGGG - Intronic
1148397740 17:47323829-47323851 CTGGGCGGTGGCGGTGGCCGCGG + Intronic
1148555832 17:48578057-48578079 CCGGGCGGTGGCGGGGGCGGCGG + Exonic
1148755056 17:49969095-49969117 GCGGGCTGTCCCGGGGGGCGGGG + Intronic
1149461493 17:56833541-56833563 GCGGGCGGGCGCGGAGGCCGAGG - Intronic
1150108557 17:62479014-62479036 CCGGGCGGCCGCGGGGGGCGCGG - Exonic
1150217080 17:63476920-63476942 CCGGGCAGGGGCGCGGGCCGGGG - Intergenic
1150791884 17:68205742-68205764 CGGGGCCGGGGCAGGGGCCGGGG - Intergenic
1152349689 17:79777924-79777946 CCGGGCGGGGGCGGGGGCGGGGG - Intergenic
1152808797 17:82371637-82371659 CCGGGAAGACGCGGGGGTCGCGG - Intergenic
1152808833 17:82371741-82371763 CCGGGCCCTGGCGCGGGGCGCGG + Intergenic
1153688259 18:7567441-7567463 CGTGGCCGTGGCGGTGGCCGTGG - Exonic
1153935310 18:9914880-9914902 CCGGGCCGGGGCAGGGGTCGGGG - Intronic
1154196543 18:12271437-12271459 CAGGGCCGCCGTGGGGGCTGCGG - Intronic
1155152795 18:23135878-23135900 CTGGGCCGGCGCGGCGGCCGCGG - Exonic
1156249971 18:35343856-35343878 TCGGGCCGGGGCCGGGGCCGGGG - Intronic
1157794274 18:50560110-50560132 CCGGGCTGTCGGGGCGACCGCGG + Exonic
1158137612 18:54224276-54224298 CGGGGCCGGGGCCGGGGCCGCGG - Exonic
1158137624 18:54224300-54224322 CGGGGCCGTGGCCGGGGACGGGG - Exonic
1158505571 18:58044109-58044131 CCGGGCTGGCGAGCGGGCCGCGG - Intergenic
1159001384 18:62978414-62978436 CCTGTCCGTCGAGGAGGCCGTGG + Exonic
1159798079 18:72867702-72867724 CCGAGCCGGGGCCGGGGCCGGGG + Exonic
1160163213 18:76491274-76491296 CGGGGCCGGGGCCGGGGCCGGGG - Intronic
1160499730 18:79395794-79395816 CCGGGCCCGCGCGGGGCCCCGGG - Intergenic
1160499763 18:79395862-79395884 CCGGGCCGGCGGGGAGGCGGGGG + Intronic
1160499894 18:79396381-79396403 CCGGGCCGTGGGGGGCGCAGGGG - Intronic
1160500781 18:79400357-79400379 CGGGGCCGGGGCGGGAGCCGGGG - Intronic
1160631211 18:80247429-80247451 GCGGGCCGGGGCCGGGGCCGGGG - Exonic
1160675863 19:390942-390964 GGGGGCCGGGGCGGGGGCCGGGG - Intergenic
1160680309 19:409076-409098 CGGGGCTGGCGCGGGGGACGCGG + Exonic
1160719296 19:590340-590362 CGGGGCCCGCGCCGGGGCCGGGG + Exonic
1160724850 19:613560-613582 CGGGGCCGGGGCCGGGGCCGGGG + Intronic
1160732488 19:647655-647677 CCGGGTCGTGGAGGCGGCCGAGG + Exonic
1160781298 19:878918-878940 CGGGGCCGGGGCCGGGGCCGGGG - Intronic
1160781302 19:878924-878946 CGGGGCCGGGGCCGGGGCCGGGG - Intronic
1160790460 19:920584-920606 CCGGGCCGGCGGGGGCGGCGGGG - Exonic
1160828095 19:1089992-1090014 CAGGGCCGTTGGGGGGGCAGGGG + Intronic
1160858938 19:1229508-1229530 CCGGGGCCGCGCGGGCGCCGGGG + Exonic
1160864420 19:1250683-1250705 CCGGGCGGGGGAGGGGGCCGAGG - Intronic
1161068806 19:2250507-2250529 CCGGGCCGTGGCGGGGGGCATGG + Intronic
1161215813 19:3094587-3094609 CAGGGCCGGGCCGGGGGCCGGGG + Exonic
1161494911 19:4581470-4581492 CCGCGCACTCGCGGCGGCCGCGG - Intergenic
1162033250 19:7926178-7926200 CGGGGCCGCCGCGGGGGGCGGGG + Intergenic
1162113359 19:8413353-8413375 CCGGGCCGGGACCGGGGCCGAGG + Intronic
1162626379 19:11888122-11888144 CCGAGCAGTCGAGGGGACCGAGG - Intronic
1162809118 19:13153755-13153777 CGGCGCCGTCGGAGGGGCCGCGG - Exonic
1162931874 19:13961496-13961518 CCGGGCCTTGGTGGGGGCCTTGG - Intergenic
1163441285 19:17323779-17323801 GCGGGCGGTGTCGGGGGCCGGGG + Exonic
1163547231 19:17947801-17947823 CGGGGCCGGGGCCGGGGCCGGGG - Intergenic
1163607098 19:18281491-18281513 CCGGGCCGGCGCGGCGGGGGAGG - Exonic
1163607280 19:18281995-18282017 CCGGGCGGGGGCGGGGGCGGGGG + Intergenic
1163708608 19:18832350-18832372 CCGGGCCGCCGGGGCCGCCGGGG - Exonic
1164693834 19:30228811-30228833 CCGGGCAGTCCCGGAGCCCGCGG - Intronic
1165349740 19:35269195-35269217 CGGGGCCGGGGCCGGGGCCGGGG - Intronic
1165938314 19:39402933-39402955 CCCGGCCGCCGCTGGGGCCGCGG + Intergenic
1165939169 19:39406775-39406797 CGGGGCCGGGGCCGGGGCCGGGG - Intergenic
1166304120 19:41928102-41928124 CCAGGACGCCGCGGGGGCCATGG - Intronic
1166541371 19:43607957-43607979 CAGCGCCTTGGCGGGGGCCGTGG - Exonic
1166677599 19:44748997-44749019 CCAGGCCGTGGGGGGGCCCGGGG - Exonic
1166746036 19:45142291-45142313 CAGGGCCGTGGCTGGGGACGGGG - Exonic
1167369473 19:49072060-49072082 CCGTGCCGTCGCGGTCGTCGCGG + Exonic
1167466067 19:49651657-49651679 CTGGGCCGTGGGGGTGGCCGAGG - Exonic
1167466136 19:49651888-49651910 CGGGGCGGGCGCGGGCGCCGGGG - Exonic
1167643684 19:50695045-50695067 CCGGGCCGGGGCTGGGGCCGCGG - Intronic
1168332786 19:55579560-55579582 CGGGGCCGTGGCCGAGGCCGTGG - Exonic
924962323 2:46134-46156 CGGGGCCGGGGCGCGGGCCGGGG + Exonic
926285259 2:11482819-11482841 CCGCGCCGTGGCCGGGGCCGGGG + Intergenic
927125992 2:20012708-20012730 CCGGGGCGGGGCGGGGCCCGAGG - Intergenic
927156549 2:20224456-20224478 CCCGGCCGCCGCGGTGGCCGGGG + Intronic
927811750 2:26184385-26184407 CCGGGCCGGGGCGCTGGCCGGGG + Exonic
927857657 2:26537447-26537469 CAGGGCCGTCGAGGTGGGCGAGG + Intronic
927881493 2:26692819-26692841 CGGGGCCGAGGCGCGGGCCGGGG + Exonic
929452881 2:42048338-42048360 CCGGGCCGTCGCGGGGGCCGCGG + Exonic
930011518 2:46941399-46941421 CCGGGCGGCAGCGGGGGCCCGGG - Exonic
931052281 2:58428410-58428432 CCGAGCCGCCGCGGGCTCCGAGG + Intergenic
931515872 2:63050534-63050556 CCTGGCCGCGGAGGGGGCCGTGG - Intronic
932036566 2:68252276-68252298 CCCGGCCGGCGCGGGCCCCGCGG - Exonic
932345856 2:70994778-70994800 CAGGCCCGTCCCGGTGGCCGGGG - Exonic
932773221 2:74513281-74513303 CAGGGCCCCCCCGGGGGCCGGGG + Intergenic
934933213 2:98445115-98445137 CGCGGCCGCCGCGGGGGCCGGGG + Intronic
934966676 2:98730555-98730577 CGGCGCTTTCGCGGGGGCCGCGG - Intronic
936104481 2:109613639-109613661 CCCGGCCGCCGCGGAAGCCGGGG + Intronic
936433268 2:112482241-112482263 CCGGGCCGCGGCGGGCGCCCGGG + Exonic
937045151 2:118847185-118847207 GGGGGCCGGCGCGGCGGCCGGGG - Exonic
938073097 2:128318639-128318661 CCGGGCCGGAGCGCGGGCGGCGG - Intergenic
940883188 2:158967980-158968002 CCCGGGCGTCCCTGGGGCCGCGG - Intergenic
941666361 2:168247289-168247311 CGGGGCCGGGGCCGGGGCCGGGG + Exonic
941666363 2:168247295-168247317 CGGGGCCGGGGCCGGGGCCGCGG + Exonic
942453623 2:176123268-176123290 GGCGGCCGTGGCGGGGGCCGGGG - Exonic
944495867 2:200306872-200306894 CCGGGCCGGAGCCGGGGCCCGGG - Intronic
946306525 2:218859749-218859771 CGGGGCCGAGGCGGGGGCGGGGG - Intergenic
946339597 2:219059121-219059143 CCGGGCCGGGCCGGGCGCCGAGG - Intronic
947623328 2:231604592-231604614 CGGGGCCGGAGCTGGGGCCGAGG + Intergenic
947636012 2:231681083-231681105 CCGGGCCGCCGCTGGGGGCTCGG + Intergenic
947641259 2:231708971-231708993 CCGGGCGCCCTCGGGGGCCGAGG + Intronic
948208230 2:236173890-236173912 CGGGGCCGTCGTGGAGGCAGCGG - Intergenic
948697313 2:239738209-239738231 CGGGGCCGGGGCCGGGGCCGGGG - Intergenic
948697317 2:239738215-239738237 CGGGGCCGGGGCCGGGGCCGGGG - Intergenic
948697368 2:239738318-239738340 CTGGGCCGGGGCTGGGGCCGGGG - Intergenic
949004499 2:241637526-241637548 CCGGGCCGACGCGAGCCCCGGGG - Intronic
1168836046 20:878125-878147 CCAGGCCGTTGTGGGGGCTGGGG - Intronic
1172118177 20:32583830-32583852 CCGGGCCGGCCCGGGGGACGGGG + Intronic
1172367910 20:34363731-34363753 CGGGGCCGGCGCGGGCGACGTGG + Intronic
1172533509 20:35652817-35652839 CAGGGCCGGGGCCGGGGCCGGGG + Exonic
1172618707 20:36306396-36306418 CGGAGCCGGGGCGGGGGCCGGGG + Exonic
1173210657 20:41029168-41029190 CCGGGCCGGGGCTGGGGTCGGGG - Intronic
1173488490 20:43458585-43458607 CCGGGCAGGCGCGAGGGCCGGGG + Intronic
1174204508 20:48828579-48828601 CCGGGCCCTCGCGGTGCCCTCGG + Intergenic
1174258697 20:49277944-49277966 GCGGGTCGGCGCGGGCGCCGGGG + Intronic
1174386600 20:50191293-50191315 CGTGGCCGTGGCGGGCGCCGGGG - Exonic
1174402379 20:50282967-50282989 CGTGGCCGAAGCGGGGGCCGTGG - Intergenic
1175847185 20:62065258-62065280 CAGGGCCGGGGCCGGGGCCGGGG + Exonic
1176113374 20:63420783-63420805 CCGGACCGGCACGGGGGCTGGGG - Intronic
1176128954 20:63488201-63488223 CCGGACCGGCGCGCGGGGCGGGG + Exonic
1176221152 20:63969848-63969870 CCGGGCCGGGGCGGGGGGCGCGG + Intronic
1176266480 20:64212153-64212175 CTGGGCCGTAGTGGGGGCCAGGG + Intronic
1176550570 21:8219157-8219179 CCGGGCCGGGACGGGGTCCGGGG + Intergenic
1176569500 21:8402198-8402220 CCGGGCCGGGACGGGGTCCGGGG + Intergenic
1176577412 21:8446427-8446449 CCGGGCCGGGACGGGGTCCGGGG + Intergenic
1176619159 21:9043158-9043180 CGGCGCAGTCGCGGGGGGCGGGG - Intergenic
1179810329 21:43865579-43865601 CCAGGCCGCCGGGGAGGCCGGGG - Intronic
1180005520 21:45018907-45018929 CGGGGCCGGGGCCGGGGCCGGGG - Intergenic
1180014794 21:45074902-45074924 GCGGGCCGTCCCGGGAGCGGAGG + Intronic
1180068231 21:45423496-45423518 CCGGGCCCTCCGGGGGGCGGGGG - Intronic
1180782801 22:18530101-18530123 CCGGGCCGGCGCCGCGGGCGCGG + Intronic
1180960521 22:19760554-19760576 CCGGGCGGTCGGGGGGCCCCGGG + Intronic
1181000882 22:19987263-19987285 GTGGGGCGTGGCGGGGGCCGGGG + Intronic
1181126363 22:20704133-20704155 CCGGGCCGGCGCCGCGGGCGCGG + Intergenic
1181239691 22:21469439-21469461 CCGGGCCGGCGCCGCGGGCGCGG + Intergenic
1181312527 22:21952876-21952898 CCTGGCCGCCGCGGGCGCCGCGG + Intergenic
1183313566 22:37124835-37124857 CCGGGCAGCCGCTGGGGCCCTGG - Intergenic
1183720131 22:39557771-39557793 CCGGGCCGGGGCGGGGGCGCGGG - Intergenic
1183780308 22:39995016-39995038 CAGGGCCGGGGCCGGGGCCGGGG + Exonic
1183780379 22:39995314-39995336 CGGCGCCGGCGCGGGGGCCTTGG - Exonic
1184236951 22:43187515-43187537 CAGGGCCTGCCCGGGGGCCGCGG - Intergenic
1184276399 22:43411753-43411775 CCGAGCCCGGGCGGGGGCCGAGG + Intronic
1184439219 22:44498304-44498326 CGGGGCCGGCGCGGTGGCGGTGG + Intergenic
1184523502 22:45008823-45008845 GCGGGGCGGGGCGGGGGCCGAGG + Intronic
1184681015 22:46072083-46072105 CCGGGCCGTCGGGCGGGCGGTGG - Intronic
1184979670 22:48086855-48086877 CCGGGTCGGGGCGGGGGTCGGGG + Intergenic
1184979684 22:48086879-48086901 CCGGGTCGGGGCGGGGGTCGGGG + Intergenic
1185037906 22:48489385-48489407 GCGGGCCGGCGCGGGGTCGGCGG + Intergenic
1185255076 22:49827417-49827439 CCGGGCCGAGGCGGCGGCGGCGG + Intronic
1185313797 22:50170394-50170416 CCGGGCCGGGGCGGCGGCGGGGG - Intergenic
1203255469 22_KI270733v1_random:135500-135522 CCGGGCCGGGACGGGGTCCGGGG + Intergenic
950400957 3:12768906-12768928 GCGGGCCGGGGCCGGGGCCGGGG + Intronic
950650213 3:14402543-14402565 CCGGGCCGGGGGCGGGGCCGGGG - Intergenic
952942290 3:38454069-38454091 CCGGGGCGACGCGGGGGCCGGGG - Exonic
953672696 3:44976126-44976148 CCCGGCAGTGGCGGCGGCCGCGG + Exonic
953705227 3:45225841-45225863 CCGGGCGCTCGGGGGGCCCGGGG + Exonic
954004232 3:47578916-47578938 CGGGGCCGGCGCGGCGGGCGGGG - Exonic
954301972 3:49705014-49705036 CCGGGCCGGGGCAGGGGCAGTGG - Exonic
954378242 3:50205889-50205911 CCGGGCCGCCTGAGGGGCCGCGG + Intronic
954912583 3:54122067-54122089 CCGGGCGGGGTCGGGGGCCGCGG - Intergenic
956675039 3:71725326-71725348 CCGGGCCCCGGCGGGGGGCGCGG + Exonic
956675067 3:71725432-71725454 GCGGGGCGGGGCGGGGGCCGGGG - Intronic
961013397 3:123449806-123449828 CCCGGGCGGCGCGGGGGGCGGGG - Intergenic
961358358 3:126352645-126352667 CTGGGCAGTGGCGGGGGCAGCGG - Exonic
961666845 3:128497953-128497975 CCGGGCTGGGGCCGGGGCCGGGG - Intergenic
961827175 3:129605300-129605322 CCGGGCGGTGGCGGCGGCGGCGG - Intronic
962975050 3:140438986-140439008 CCTGGCTGTCTGGGGGGCCGTGG - Intronic
963133131 3:141876607-141876629 CCGGGCGGCCGCTTGGGCCGCGG - Exonic
963827408 3:149970562-149970584 CCGGGCGGGCGGGGAGGCCGAGG - Intronic
964201223 3:154121388-154121410 GCGGGCCGGCGCCGGCGCCGCGG + Intronic
965590829 3:170358308-170358330 CCGCCCCCCCGCGGGGGCCGCGG - Intronic
966684826 3:182682729-182682751 CCGGGCCGGCGCGCGGGGGGCGG - Intergenic
966866534 3:184261497-184261519 CCGGGCGGGGGCGGGGGCGGGGG + Intronic
966886445 3:184380177-184380199 CGGGGCCGGGGCCGGGGCCGGGG - Exonic
968173472 3:196528890-196528912 CTGGGCGGTGGCGGGGGCCGCGG + Intergenic
968341576 3:197960186-197960208 CGGGGCCGGCGCGGGCGCAGAGG + Intronic
968511445 4:997564-997586 GCGGGGTGTCGCTGGGGCCGCGG - Intronic
968583609 4:1406010-1406032 CCGCGCCCTCGCCGGCGCCGGGG - Exonic
968653841 4:1770350-1770372 CCGGGCTGCCGCGGGGCCCAGGG - Intergenic
968660915 4:1798355-1798377 GCGGGCCCTCAAGGGGGCCGGGG - Intronic
968674980 4:1872045-1872067 CGGGGCCGGCGCCGGGGCCAGGG + Intronic
968697531 4:2040524-2040546 CCGCGCTGTTGCCGGGGCCGCGG - Intronic
968750605 4:2387058-2387080 CGGGGCCGGGGCCGGGGCCGGGG + Intronic
968775402 4:2536873-2536895 CAGAGCGGGCGCGGGGGCCGCGG - Intronic
968820202 4:2844119-2844141 CCGGGCCGCCGCAGGCCCCGCGG - Intronic
972543312 4:40057277-40057299 CCGGGCGAAGGCGGGGGCCGCGG + Intronic
973293324 4:48490699-48490721 CCCGGCCGGCCCCGGGGCCGAGG + Exonic
976199015 4:82561547-82561569 CGGGGCCGGGGCCGGGGCCGGGG + Intronic
985006012 4:185535666-185535688 CCGGGCCGCGGCGGGCGCGGGGG + Intergenic
985068352 4:186144723-186144745 CGGGGCCGGGGCCGGGGCCGGGG + Intronic
985629855 5:1008750-1008772 CGGGGGCGCTGCGGGGGCCGCGG + Intergenic
985660672 5:1155432-1155454 CCGAGCCGGGGCAGGGGCCGCGG - Intergenic
985782537 5:1878640-1878662 CCGGGCCGTCGGGCGCGGCGGGG + Exonic
986330521 5:6713658-6713680 CGGGGCGGGCGCGGGGGCCGCGG - Intergenic
986695930 5:10354108-10354130 CCGCGCCGCCGAGGGGGGCGGGG + Intronic
986695946 5:10354137-10354159 CCGGGCAGGGGCCGGGGCCGGGG + Intronic
988825325 5:34929741-34929763 CCGGGCCGAAGCGGCGGCGGCGG - Exonic
990825431 5:59893357-59893379 CCGGGCGGCGGCGGGGGCGGCGG + Exonic
990900445 5:60743695-60743717 CCAGGCCGTAGCTGAGGCCGGGG + Intergenic
990955153 5:61332812-61332834 CGCCGCCGCCGCGGGGGCCGGGG + Exonic
992105586 5:73447413-73447435 CCGTGCGGTGGCGGGGGCGGCGG + Exonic
995142565 5:108749368-108749390 CCGCCCCGTCGCGGGGTCTGGGG + Intronic
996432865 5:123401026-123401048 CCAGGCCGTAGCTGAGGCCGGGG + Intronic
997521380 5:134526332-134526354 CCGGGCCGGCGAGGGGGCGCGGG + Intronic
997643667 5:135466306-135466328 CCAGGGCGTGGAGGGGGCCGGGG - Intergenic
997647645 5:135491647-135491669 CCGGGCGGGCGCGTGGGGCGGGG + Intergenic
997653009 5:135536029-135536051 CCGGGCTGCCGCGGGGGCGGAGG - Intergenic
998166797 5:139848734-139848756 CCGGGCCGGCGCGGGGGAGGGGG + Intronic
999248290 5:150167037-150167059 CCAGGCCGTCGGGGGCGCGGGGG - Exonic
999767974 5:154755410-154755432 CCGGGCCGCCCCGGGGGCGGGGG + Intronic
1001381972 5:171311300-171311322 CCCGGCCCTCCCGGGAGCCGAGG - Intronic
1001395998 5:171419956-171419978 CCGGGCTGGCGCAGGGGCTGCGG - Exonic
1002163684 5:177332127-177332149 CTGCGCCGTGGTGGGGGCCGTGG - Exonic
1002170332 5:177371068-177371090 CCGGGCCGGGGCCGGGGCCGGGG + Intronic
1002170336 5:177371074-177371096 CGGGGCCGGGGCCGGGGCCGGGG + Intronic
1002170340 5:177371080-177371102 CGGGGCCGGGGCCGGGGCCGGGG + Intronic
1002170344 5:177371086-177371108 CGGGGCCGGGGCCGGGGCCGGGG + Intronic
1002170348 5:177371092-177371114 CGGGGCCGGGGCCGGGGCCGGGG + Intronic
1002170352 5:177371098-177371120 CGGGGCCGGGGCCGGGGCCGGGG + Intronic
1002173455 5:177387991-177388013 CAGGGCCTTCGCGGGGGCCACGG + Exonic
1002888970 6:1317396-1317418 CTCGGCCGACGCGGGGGGCGCGG + Intergenic
1002927248 6:1611576-1611598 CGGCGGCGGCGCGGGGGCCGCGG + Exonic
1003116411 6:3286641-3286663 CCGGGCCGGGGCAGGGGCAGGGG + Intronic
1004216636 6:13710772-13710794 CCGGGTGGGCGCGGGGGTCGCGG - Intronic
1004627915 6:17393906-17393928 CGGCGCGGGCGCGGGGGCCGGGG + Intronic
1006304085 6:33208515-33208537 CCGGGCCATGGCGGCGGCGGTGG + Exonic
1007378209 6:41470525-41470547 CTGGGCCAGCGCGGGGGCCGGGG + Intergenic
1007591154 6:43021672-43021694 CCGCGCCGGGGCCGGGGCCGGGG + Exonic
1007591158 6:43021678-43021700 CGGGGCCGGGGCCGGGGCCGGGG + Exonic
1007669466 6:43539558-43539580 CCGGGCCGGGGCTGAGGCCGCGG - Intronic
1007673480 6:43575953-43575975 CCGGGCCGCGGCGGGCGGCGGGG + Exonic
1007701769 6:43770112-43770134 CCGGCCCGCCCCGGGGGGCGGGG - Intergenic
1010244795 6:73653511-73653533 CCGGGCGGGGGCGGGGGCGGGGG - Intronic
1013372671 6:109483549-109483571 CGGGGCCGGGGCCGGGGCCGGGG + Intergenic
1015251915 6:131135789-131135811 CCGGGCTGTCCAGCGGGCCGGGG + Intronic
1015965369 6:138692373-138692395 CTGGGTCGGCGCGGGGGCCGCGG - Intronic
1016936325 6:149451354-149451376 CCGGCCTGGCGCGGGCGCCGAGG - Exonic
1019197618 6:170291367-170291389 CCGGGCCGCGGCGGCAGCCGAGG + Intergenic
1019406558 7:887131-887153 CCTGGCCGAGGCGGGGGCTGGGG - Intronic
1019433928 7:1012203-1012225 AGGGGCCGCCGCGGTGGCCGAGG + Intronic
1019723266 7:2586523-2586545 CCGGGGCATCGCGTGGCCCGCGG - Intronic
1020125412 7:5530383-5530405 CCGGACCGCCGTGGGGGGCGCGG - Intronic
1020383090 7:7567116-7567138 CCGGCCCCTCGCTGCGGCCGCGG - Intronic
1021600221 7:22356985-22357007 CCTGGCCGCCGCGGCGGCGGTGG - Intronic
1022427953 7:30285551-30285573 CGGGGCCGCCGCGGCCGCCGCGG - Exonic
1023289694 7:38656460-38656482 CCAGGCCGTAGCTGAGGCCGGGG - Intergenic
1024579789 7:50792837-50792859 GCGGGCTGTGGCGGGGGCTGCGG - Intronic
1024579893 7:50793149-50793171 CCTGGCCGTCCCGGGCCCCGCGG + Intronic
1026806913 7:73434536-73434558 CCGGGAGGGCGCGCGGGCCGCGG - Exonic
1028796290 7:94907758-94907780 CCGGGCCGTTTCGGCGGCCGCGG - Intronic
1029123213 7:98281763-98281785 CCGGGCCGGAGCGGCGGGCGCGG + Exonic
1029614256 7:101646205-101646227 CCGGGCCTTCGCCAGGGTCGCGG - Intergenic
1031043572 7:116862983-116863005 CGGGGCCTCCGCCGGGGCCGGGG + Intronic
1031051884 7:116953441-116953463 CCGGGCCGCGGCGGCGGCGGCGG + Exonic
1032020653 7:128405701-128405723 CAGGGCCGGCCCGGGGGTCGCGG + Intronic
1032068796 7:128791508-128791530 CGGAGCCGGCGCGGGAGCCGCGG + Intronic
1032263150 7:130352340-130352362 CTGGAGGGTCGCGGGGGCCGGGG + Intronic
1033654153 7:143362149-143362171 CGGGGCTGGCGCGGAGGCCGAGG + Intronic
1033662060 7:143408881-143408903 CCGGGCGGGGGCGGGGGGCGGGG + Exonic
1034166404 7:149028333-149028355 GCTGGCCGTGGCGGGTGCCGAGG - Exonic
1034445984 7:151114694-151114716 CCGGGCCGGGGCCGCGGCCGGGG - Intronic
1034483612 7:151341986-151342008 CTGGGCCGGGGCCGGGGCCGGGG + Intronic
1034911670 7:155002985-155003007 GCCGGGCGCCGCGGGGGCCGGGG - Exonic
1034977609 7:155457603-155457625 CCGAGCCCGCGCGGAGGCCGAGG + Intergenic
1036558794 8:9884143-9884165 CTCGGCCGTCACGGGGGCTGTGG + Intergenic
1039903153 8:41767268-41767290 CGGGGCCGGGGCCGGGGCCGGGG - Intronic
1041781187 8:61579515-61579537 CCAGGCCGTAGCTGAGGCCGGGG - Intronic
1043502943 8:80874262-80874284 GCGGGGCGGCGCGGCGGCCGCGG + Intronic
1044242371 8:89902420-89902442 CCGGCCCCTCGCCCGGGCCGTGG + Intronic
1046770356 8:118111670-118111692 CCGGGCCGCCGCGCGTCCCGGGG - Exonic
1047951494 8:129939442-129939464 CCGGGGCGTCGCGGGGCCGGGGG + Intronic
1049194679 8:141308605-141308627 CGGGGCCGGGGCCGGGGCCGGGG - Intergenic
1049419570 8:142510818-142510840 GCGGGCCGGGGCCGGGGCCGGGG + Intronic
1049474545 8:142790619-142790641 CCGGGCCGGGCCAGGGGCCGGGG + Intergenic
1049668511 8:143859327-143859349 CCGGGCCGAGGCCGAGGCCGAGG - Exonic
1050092483 9:2029060-2029082 CAGGGCCTTCGCCGGGGCCTGGG + Exonic
1052903991 9:33817744-33817766 CTGGGCCATCGCGGCGGCGGCGG - Exonic
1053001158 9:34577960-34577982 CGGGGGCGTCGCGGCGGCGGGGG + Intronic
1053163489 9:35829322-35829344 CGGGCCCGGGGCGGGGGCCGGGG - Intronic
1053188237 9:36037043-36037065 GCTGGCCGTGGCGGGGGTCGCGG + Exonic
1055576146 9:77661760-77661782 CCAGGCTGTCGTGGGGGCTGAGG + Intergenic
1055785201 9:79863729-79863751 CGGGGCCGGGGCCGGGGCCGGGG - Intergenic
1056643407 9:88388988-88389010 CCGGGCCGGCGACGGGGGCGGGG + Intronic
1058439084 9:104991216-104991238 CGGGGCCGGCGCTGGGGCGGGGG - Intergenic
1060283496 9:122228891-122228913 CCGGGGCTGCGCGCGGGCCGGGG - Intronic
1060355690 9:122905146-122905168 CCGCGCCGTCGCGGGGCTCCCGG - Intronic
1060969905 9:127731996-127732018 CCTGGCCATCAGGGGGGCCGAGG + Exonic
1061165668 9:128920842-128920864 CCAGGCCGTCCGGGGGGCAGGGG - Intergenic
1061275895 9:129569211-129569233 CGGGGCCGGGGCCGGGGCCGGGG + Intergenic
1061275899 9:129569217-129569239 CGGGGCCGGGGCCGGGGCCGGGG + Intergenic
1061293708 9:129666157-129666179 CGGGGCCGGGGCCGGGGCCGGGG + Intronic
1061293712 9:129666163-129666185 CGGGGCCGGGGCCGGGGCCGGGG + Intronic
1061540780 9:131277100-131277122 CGGGGCGGGCGCGGGGGGCGGGG - Intergenic
1061559649 9:131394270-131394292 CGGGGCCGGGGCCGGGGCCGGGG + Intronic
1061975793 9:134067591-134067613 CCGGGCTGGCGCGGGGCGCGCGG + Intronic
1061975801 9:134067638-134067660 TCGGGGCGTCGCTGCGGCCGGGG - Intronic
1062272140 9:135714459-135714481 CCGGTGGGTCGCGGTGGCCGCGG + Intronic
1062389340 9:136327769-136327791 ACGGGCCGGGGCCGGGGCCGGGG + Intronic
1062389344 9:136327775-136327797 CGGGGCCGGGGCCGGGGCCGGGG + Intronic
1062491646 9:136807888-136807910 ACGGGGCGCCGCGAGGGCCGCGG - Intergenic
1062507731 9:136886647-136886669 CCGGGCCGGAGCGGGAGCGGGGG + Intronic
1062558860 9:137130179-137130201 GCGCGGCGTCGCGGGGGCCGAGG + Intergenic
1062587411 9:137255485-137255507 CCGGGCGGTGGCCGGGGCCTCGG + Exonic
1203775685 EBV:71904-71926 CCGGCCAGTGGCCGGGGCCGTGG - Intergenic
1203792152 EBV:157515-157537 CAGGGACTTCCCGGGGGCCGTGG + Intergenic
1203471865 Un_GL000220v1:118635-118657 CCGGGCCGGGACGGGGTCCGGGG + Intergenic
1186463350 X:9765626-9765648 CGGGGACGTCGCGGGGGACCCGG + Exonic
1186466239 X:9786354-9786376 CGGGGCCGGGGCCGGGGCCGGGG - Intergenic
1186466243 X:9786360-9786382 CGGGGCCGGGGCCGGGGCCGGGG - Intergenic
1190385625 X:49879948-49879970 CGGGGCCGGGGCGGGGGCCGGGG - Exonic
1190385634 X:49879960-49879982 CCGCGCCGGGGCCGGGGCCGGGG - Exonic
1190783989 X:53625852-53625874 CAGGGCCGGGGCCGGGGCCGGGG + Intronic
1190783993 X:53625858-53625880 CGGGGCCGGGGCCGGGGCCGGGG + Intronic
1192152003 X:68718365-68718387 CGGGGCCGGGGCTGGGGCCGGGG - Exonic
1193963593 X:87955187-87955209 CCGGGGCCTCTCGGGGGCTGGGG + Intergenic
1195157991 X:102142211-102142233 GCGGGCCGGGGCGGGGGCAGGGG - Intronic
1195269396 X:103215349-103215371 CGGGCCCGCCGCGGGGCCCGGGG - Intronic
1198800071 X:140439479-140439501 GCCGGCCGTCTCGGGGGGCGCGG + Intergenic
1199927313 X:152480868-152480890 CCAGGCCGTAGCTGAGGCCGGGG - Intergenic
1200100699 X:153688111-153688133 CCCGGCCGGGGCGGGGGGCGCGG + Exonic
1200209649 X:154341591-154341613 CGGGGCCGGGGCCGGGGCCGGGG + Intergenic
1200209653 X:154341597-154341619 CGGGGCCGGGGCCGGGGCCGGGG + Intergenic
1200209657 X:154341603-154341625 CGGGGCCGGGGCCGGGGCCGGGG + Intergenic
1200221195 X:154390489-154390511 CGGGGCCGGGGCCGGGGCCGGGG - Intronic
1200221199 X:154390495-154390517 CGGGGCCGGGGCCGGGGCCGGGG - Intronic
1200221203 X:154390501-154390523 CGGGGCCGGGGCCGGGGCCGGGG - Intronic
1200221207 X:154390507-154390529 CGGGGCCGGGGCCGGGGCCGGGG - Intronic
1200221211 X:154390513-154390535 CGGGGCCGGGGCCGGGGCCGGGG - Intronic
1200221215 X:154390519-154390541 CGGGGCCGGGGCCGGGGCCGGGG - Intronic
1200221219 X:154390525-154390547 CGGGGCCGGGGCCGGGGCCGGGG - Intronic
1200221223 X:154390531-154390553 CGGGGCCGGGGCCGGGGCCGGGG - Intronic
1200221227 X:154390537-154390559 CGGGGCCGGGGCCGGGGCCGGGG - Intronic
1202372171 Y:24205938-24205960 CCAGGCGGTAGCGGGGGCTGTGG - Intergenic
1202498614 Y:25464178-25464200 CCAGGCGGTAGCGGGGGCTGTGG + Intergenic