ID: 929453430

View in Genome Browser
Species Human (GRCh38)
Location 2:42050905-42050927
Sequence GGGCAGGAAGACCCCACTGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 232
Summary {0: 1, 1: 0, 2: 2, 3: 27, 4: 202}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
929453430_929453439 3 Left 929453430 2:42050905-42050927 CCTACAGTGGGGTCTTCCTGCCC 0: 1
1: 0
2: 2
3: 27
4: 202
Right 929453439 2:42050931-42050953 AGGCTTCAGGGCAGGTGTACAGG 0: 1
1: 0
2: 1
3: 19
4: 258
929453430_929453436 -5 Left 929453430 2:42050905-42050927 CCTACAGTGGGGTCTTCCTGCCC 0: 1
1: 0
2: 2
3: 27
4: 202
Right 929453436 2:42050923-42050945 TGCCCAGGAGGCTTCAGGGCAGG 0: 1
1: 0
2: 2
3: 40
4: 413
929453430_929453433 -10 Left 929453430 2:42050905-42050927 CCTACAGTGGGGTCTTCCTGCCC 0: 1
1: 0
2: 2
3: 27
4: 202
Right 929453433 2:42050918-42050940 CTTCCTGCCCAGGAGGCTTCAGG 0: 1
1: 2
2: 2
3: 46
4: 344
929453430_929453434 -9 Left 929453430 2:42050905-42050927 CCTACAGTGGGGTCTTCCTGCCC 0: 1
1: 0
2: 2
3: 27
4: 202
Right 929453434 2:42050919-42050941 TTCCTGCCCAGGAGGCTTCAGGG 0: 1
1: 0
2: 2
3: 27
4: 303
929453430_929453440 4 Left 929453430 2:42050905-42050927 CCTACAGTGGGGTCTTCCTGCCC 0: 1
1: 0
2: 2
3: 27
4: 202
Right 929453440 2:42050932-42050954 GGCTTCAGGGCAGGTGTACAGGG 0: 1
1: 0
2: 2
3: 23
4: 310

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
929453430 Original CRISPR GGGCAGGAAGACCCCACTGT AGG (reversed) Intronic
902737784 1:18412667-18412689 GGGAAGGAAGACCCCATCCTTGG - Intergenic
903054342 1:20625116-20625138 GGGCAGGAGGAACCCATTGGTGG - Intergenic
907272319 1:53298279-53298301 GGACAGGAAGACGCCTTTGTCGG - Intronic
907489396 1:54799475-54799497 GGAGAAGAAGGCCCCACTGTGGG + Intronic
908246439 1:62230974-62230996 GGGCTGGATGACTCCACTGTGGG + Intergenic
909327941 1:74375884-74375906 GGGCAAGGAGAACCCACTGAAGG + Intronic
909663748 1:78111314-78111336 GGGGAAGAAGAGCCCACTGAGGG - Intronic
911418972 1:97615391-97615413 GGTCAGAATCACCCCACTGTTGG - Intronic
912124940 1:106524372-106524394 AGCCAGGAAGTCACCACTGTGGG - Intergenic
913045189 1:115068204-115068226 GGGCAGGAGGATCCAGCTGTGGG - Intronic
915291902 1:154889995-154890017 AGGCTGGAAGACTCCAGTGTTGG - Intergenic
916060318 1:161093770-161093792 TGACACTAAGACCCCACTGTGGG + Intergenic
916390226 1:164322474-164322496 GGGCAGAGAGAGCCCACTCTGGG + Intergenic
919851065 1:201673240-201673262 GGGCAGGCAGGCCCCACAGATGG + Intronic
920372135 1:205485659-205485681 GGGCAGGAAGTCCCTGCTGGCGG - Intergenic
1062876618 10:948040-948062 AGGCAGGAGGACCTCACTCTTGG - Intergenic
1063283805 10:4661217-4661239 AGACAGCAAGAGCCCACTGTGGG + Intergenic
1064370627 10:14749373-14749395 GGGAAGGAGGACCTCACTGGTGG - Intronic
1067460161 10:46452293-46452315 GGGCAGGGAGGCCCATCTGTGGG - Intergenic
1067526330 10:47040936-47040958 GGGAAGCAAGCACCCACTGTCGG + Intergenic
1067627029 10:47932310-47932332 GGGCAGGGAGGCCCATCTGTGGG + Intergenic
1067729111 10:48796410-48796432 GTGCTGGAAGACACCAGTGTTGG - Exonic
1067940496 10:50650971-50650993 GGGCATGTGGATCCCACTGTAGG - Intergenic
1069692633 10:70363933-70363955 GGGCTGGAGGTCCCCACTGCAGG - Intronic
1072891476 10:99329210-99329232 GGGCAGGAGGTCCCCGCTGGAGG - Exonic
1074788820 10:116865767-116865789 GGGCTGGATCACCCCACTGTGGG - Intronic
1076822449 10:132946257-132946279 GGGGACAAAGACCACACTGTGGG + Intergenic
1078362022 11:10676425-10676447 GGGGTGGTTGACCCCACTGTGGG + Intronic
1079121242 11:17686554-17686576 GAGCAGGAATTCCCCACTGGGGG - Intergenic
1079333340 11:19551169-19551191 GGGCAGGCAAACCCCAAAGTGGG - Intronic
1080789606 11:35510396-35510418 GGGCAGTAAAACCACTCTGTAGG - Intronic
1082820707 11:57542940-57542962 GAGAAGGAAGAGACCACTGTGGG + Exonic
1084067086 11:66710854-66710876 GGGCAGTAAGACCCCTCAGCCGG + Intronic
1084559551 11:69895223-69895245 TGGCAGGAAGACCCCACAGATGG - Intergenic
1085328700 11:75628533-75628555 GGGCAGTAGAAGCCCACTGTAGG + Intronic
1089954290 11:122556026-122556048 CGGCAGGCAGACCCCACAGGTGG - Intergenic
1090266634 11:125357324-125357346 GGGCATAAAGGCCCCACGGTTGG - Intronic
1090425492 11:126604276-126604298 GGGCAGGAAGACCACCCTGAAGG + Intronic
1091106124 11:132921361-132921383 GGCCTGGAAGGGCCCACTGTGGG - Intronic
1092170269 12:6370022-6370044 TGTCTGGAAGAACCCACTGTGGG - Intronic
1096586136 12:52621206-52621228 TGGCAGGACAGCCCCACTGTGGG - Intergenic
1096818193 12:54214979-54215001 GGGACCGAAGACCCCGCTGTGGG - Intergenic
1103126248 12:118424937-118424959 GCGAAGGATGACCCCACAGTGGG - Intergenic
1104368109 12:128196180-128196202 GGGCAGGAAGAACCCTTTGGTGG - Intergenic
1109101675 13:58192278-58192300 GGGTAGTAAGACCCCAATCTTGG - Intergenic
1110281499 13:73699126-73699148 AGGCAGGAAGATCCCACTTGAGG + Intronic
1110815032 13:79851957-79851979 GGGCAGAAAGACATCAGTGTTGG + Intergenic
1111208240 13:85041014-85041036 GGGCAGGAAAACCCCAAATTGGG + Intergenic
1113348049 13:109499875-109499897 GGAAAGGAAGTCCCCTCTGTTGG + Intergenic
1113553964 13:111216369-111216391 GGGCAGGGAGAAGCCAGTGTGGG + Intronic
1118008630 14:61587999-61588021 GGGAAAGAAGACCCCACTCTTGG - Intronic
1118448136 14:65870432-65870454 GGTCTGGAAGACCTCACTGGAGG + Intergenic
1121002067 14:90458647-90458669 GGGCTAGAAGACCCCACAGTGGG + Intergenic
1121656254 14:95598003-95598025 TAGCAGGGAGTCCCCACTGTCGG - Intergenic
1121904579 14:97728111-97728133 TGGCAGGAAGACCCCAAGGTAGG + Intergenic
1122044246 14:99012053-99012075 GAGCAGTGAGACCCCACTGTGGG - Intergenic
1122203465 14:100136499-100136521 GGGGAGGAAGACCCCAGGGTTGG + Intronic
1123583631 15:21738149-21738171 GAGGAGGAAGGCGCCACTGTCGG + Intergenic
1123620281 15:22180752-22180774 GAGGAGGAAGGCGCCACTGTCGG + Intergenic
1124619293 15:31264868-31264890 GGGAGGAAAGGCCCCACTGTGGG + Intergenic
1125316928 15:38441675-38441697 GGGCAAGAAGACTGCACTGGGGG + Intergenic
1125892594 15:43277419-43277441 GGGCAGGATGACATCACTGATGG - Intronic
1127774069 15:62252091-62252113 GGGCACCCAGCCCCCACTGTGGG + Intergenic
1127847493 15:62883964-62883986 GGGCAGGAGGACCCTTCTTTTGG - Intergenic
1128868797 15:71136697-71136719 GTTCAGGAAGGCCCCACTGCAGG - Intronic
1131617224 15:94029149-94029171 GGGCAAGAAGGCCCCACCTTCGG + Intergenic
1131918683 15:97300158-97300180 GCGCATGAAGACCCAACTGCAGG - Intergenic
1132050855 15:98606652-98606674 GGCCAGGTAGACTCCACTGAGGG - Intergenic
1133022789 16:2974214-2974236 GGGCAGGCAGCCGCCACTGTCGG + Intronic
1133140584 16:3740916-3740938 GGGCAGGAGGAGCCCACTGAGGG - Intronic
1133971239 16:10569769-10569791 GTGCATGCAGACCCCACTCTGGG + Intronic
1134742465 16:16560076-16560098 GCCCAGGGAGACCCCACTGGAGG + Intergenic
1134813142 16:17184234-17184256 GGGCAGGAAGATGCCAGGGTTGG + Intronic
1134925098 16:18152383-18152405 GCCCAGGGAGACCCCACTGGAGG - Intergenic
1137724006 16:50645014-50645036 GGGCAGGAAGTGCCAAGTGTGGG - Intergenic
1137852184 16:51756656-51756678 CGGCAGGAAGCCCCCACAGCGGG - Intergenic
1137938285 16:52656521-52656543 GCCCAGGGAGACTCCACTGTGGG + Intergenic
1138428636 16:56953161-56953183 GGGCAGGAAGGCTTCACTCTAGG + Intergenic
1138925205 16:61581837-61581859 GGGCAGGAAGCCCGCACTTCCGG - Intergenic
1139467162 16:67160083-67160105 CGGCAGGAAGACCCGACTTTGGG + Exonic
1139670967 16:68492411-68492433 GGGGAGGAGGGCCCCACTGGTGG - Intergenic
1141015941 16:80449407-80449429 GGGCTGGAGGAACCCATTGTTGG - Intergenic
1141269121 16:82522863-82522885 GAGCAGGAGGAGCACACTGTGGG + Intergenic
1141392767 16:83678379-83678401 AGGCAGGAGGACCTCTCTGTGGG + Exonic
1141949111 16:87329374-87329396 GGGCTTGAAGAGCACACTGTGGG - Exonic
1142190211 16:88713950-88713972 TGACAGGAGGACCCCACAGTGGG + Intronic
1143487086 17:7261163-7261185 GAGCAGGAAGGCCGCGCTGTCGG - Intronic
1144515277 17:15913154-15913176 GGGAAGGAAGAGCCAGCTGTGGG - Intergenic
1147168856 17:38606605-38606627 GGCCAGTGAGACCCCACCGTAGG + Intergenic
1147384070 17:40071544-40071566 GGACAGCAAGACCCACCTGTCGG - Intronic
1147458746 17:40555024-40555046 GGCCAGGACCACCCCATTGTAGG + Exonic
1148511879 17:48177987-48178009 GGGCATGAAGACTCATCTGTAGG - Intronic
1148896771 17:50843458-50843480 GTTCAGGAAAATCCCACTGTGGG + Intergenic
1150006165 17:61470277-61470299 GAGCAGGAAGCCCTGACTGTCGG + Intronic
1152920959 17:83066430-83066452 GCCCAGGAAGCCCGCACTGTGGG - Intergenic
1155191762 18:23436969-23436991 CCGCAGTAAGACCCCACAGTGGG + Intronic
1160948881 19:1656222-1656244 GAGCAGGAAGCCCCCACTTTGGG - Intergenic
1161498369 19:4599268-4599290 GGCATGGAAGACCCCACTGTGGG - Intergenic
1162496454 19:11025780-11025802 ACGCAGCAGGACCCCACTGTGGG - Intronic
1164521776 19:28985161-28985183 GGGCAGGACAAACCCGCTGTCGG + Intergenic
1164533134 19:29063164-29063186 GGGCAGGAAGAAGCCCCTGCAGG - Intergenic
1165850019 19:38844454-38844476 GGGCAGGAAAAAGCCACTGATGG - Intronic
1166345374 19:42162175-42162197 GGGCAGGGAGACTCAAGTGTGGG - Intronic
1167667795 19:50832821-50832843 GGGGAGGCAGACACCACTGAGGG - Intronic
925177008 2:1793166-1793188 ATGCAGGAAGACCACCCTGTGGG - Intronic
925316690 2:2932042-2932064 GGGCAGGAAAATCCTGCTGTAGG + Intergenic
925473639 2:4189249-4189271 GGGCATGGTGCCCCCACTGTGGG + Intergenic
925786848 2:7439880-7439902 GGCCAGGAAGACCACTATGTAGG + Intergenic
927077601 2:19595626-19595648 GGGCAGGAAGCATCCAGTGTGGG - Intergenic
929453430 2:42050905-42050927 GGGCAGGAAGACCCCACTGTAGG - Intronic
931441501 2:62293661-62293683 AGGCAGGATGCCCCCACTGGTGG + Intergenic
932569980 2:72933573-72933595 GGGCAGGAAGAGGACACAGTGGG - Intronic
933503579 2:83147626-83147648 GGGCAGGAAAACCCCAAAGTGGG - Intergenic
935680956 2:105636452-105636474 TGACAAGAAAACCCCACTGTTGG - Intergenic
935794956 2:106632015-106632037 GTGCAGGAAGGCTCCACTGACGG + Intergenic
936055032 2:109256208-109256230 GACAAGGAAGACCCCACAGTTGG + Intronic
936583162 2:113724554-113724576 GGGCAGGGAGACAGCACTGTAGG + Intronic
937474622 2:122204121-122204143 GGGCAGGAAGATGGCACTGAAGG + Intergenic
938263572 2:129911335-129911357 GGGAAGACAGATCCCACTGTGGG - Intergenic
942145973 2:173026584-173026606 GAACAGGAAGGCCCAACTGTTGG + Exonic
942221896 2:173776883-173776905 GGGCAGGAAGCATCCAGTGTGGG - Intergenic
942378130 2:175357743-175357765 GGGCCTGAAGACCCCTCTGGTGG + Intergenic
943080238 2:183251185-183251207 GGGCAGGAAGCATCCACTATGGG + Intergenic
944592281 2:201228969-201228991 GGGCAGGAAGAGAACAGTGTGGG + Intronic
945971747 2:216237792-216237814 TGGCTTGAAGAACCCACTGTGGG + Intergenic
945971752 2:216237811-216237833 TGGGAGGATGAACCCACTGTGGG + Intergenic
945971757 2:216237830-216237852 TGGGAGGATGAACCCACTGTGGG + Intergenic
946067695 2:217003360-217003382 GGGGAGGAAAGCCCCTCTGTGGG + Intergenic
946471747 2:219967046-219967068 GGGCAGGAAGAACCCATAGGTGG + Intergenic
947833575 2:233159232-233159254 GGTCACAAAGAACCCACTGTGGG - Intronic
948564025 2:238872137-238872159 GGGCAGGCAGGACCCACTGTGGG - Intronic
948916245 2:241036176-241036198 GGGCGGGAAGACCCATCTGAGGG + Intronic
948979544 2:241485808-241485830 GGGAAGGAGGACCCTACTGGGGG - Intronic
948979569 2:241485876-241485898 GGGAGGGAGGACCCCACTGGGGG - Intronic
1170669681 20:18420316-18420338 GTGCATGGAGACCCCACTGCAGG + Intronic
1170753719 20:19177000-19177022 GGGCAGGAAAGCCCCAAAGTTGG - Intergenic
1172902251 20:38343891-38343913 GAGCAGCACGACCCCACTGCTGG - Intergenic
1173020921 20:39267739-39267761 GAGCAGTAATAACCCACTGTAGG - Intergenic
1174158698 20:48534954-48534976 GGGCAGGTAAGCCCCACAGTGGG + Intergenic
1174672893 20:52324387-52324409 GGTCAGGAAGTCCTCACTGCAGG + Intergenic
1175376967 20:58534548-58534570 GGGAAGGAAGATCTCACTGCTGG + Intergenic
1175465236 20:59186157-59186179 GTCCAGCAAGTCCCCACTGTGGG - Intergenic
1179456609 21:41505056-41505078 GGGCAGGGAGAGCTCCCTGTGGG - Intronic
1180210293 21:46291838-46291860 GGGCAGGAAGAACCCATAGGTGG - Intronic
1180786192 22:18549173-18549195 GAGCGGGAAGACCCCTCTGTGGG + Intergenic
1180917703 22:19500243-19500265 GAGCAGGAAGACCCCACTCTAGG - Intronic
1181131477 22:20734899-20734921 GAGCGGGAAGACCCCTCTGTGGG + Intronic
1181243114 22:21488727-21488749 GAGCGGGAAGACCCCTCTGTGGG + Intergenic
1181562567 22:23714453-23714475 TGGCAGGAAGACCACAGGGTGGG + Intergenic
1182446263 22:30391381-30391403 GGGCCAGAAGCCCCCACTGATGG - Intronic
1183526975 22:38328847-38328869 GGGTGGGAAGGGCCCACTGTGGG + Intronic
1183661338 22:39223280-39223302 GGGGAGGGAGTGCCCACTGTGGG - Intergenic
1185072264 22:48662808-48662830 GGCCAGGATGGCCCCTCTGTGGG - Intronic
950988281 3:17400798-17400820 GGGCAGGAAGCATCCACCGTGGG - Intronic
951388299 3:22069830-22069852 ACGTAGGAAAACCCCACTGTAGG + Intronic
952605374 3:35141535-35141557 GGGCAGGAAGAATCCACCATGGG + Intergenic
952665146 3:35895157-35895179 AGGCAAGAAGAACCCACTTTGGG + Intergenic
952881381 3:37988061-37988083 GGGCGGGAAGGGCCCTCTGTGGG + Exonic
954128736 3:48548895-48548917 GGGCAGGAACTCCCTGCTGTGGG - Intronic
954653144 3:52177519-52177541 GGGCAGGAACTCCCCAAAGTGGG - Intergenic
955881438 3:63550850-63550872 GGCCAAGAAGACCCCACAATGGG + Intronic
957684244 3:83479964-83479986 GGGAAGGAAGACCACAGAGTGGG + Intergenic
959567698 3:107849386-107849408 GGACAGGAAGACCCCAGAGAGGG + Intergenic
960949656 3:122991079-122991101 GGGAAGGAAAATCCCACTGTTGG - Intronic
962978435 3:140466536-140466558 GAGCAGGAAGACTCCTCTGGTGG + Intronic
965461049 3:168963753-168963775 GGGCAGGAAGCACCCAGTGTGGG + Intergenic
966613355 3:181889903-181889925 GGGCAGAAAGAGCCCAGGGTAGG + Intergenic
966700365 3:182842574-182842596 GGGCAGGAAGGACCCTCTCTGGG + Intronic
968627588 4:1634152-1634174 AGGCAGGCAGAGTCCACTGTGGG - Intronic
972393365 4:38634262-38634284 GGTCAGGCAGACCGCACAGTTGG - Intergenic
973635996 4:52862416-52862438 GGGCGGGAGGACCCGACTGCGGG - Exonic
974289880 4:59915344-59915366 GGGCAGGAAGCAACCAGTGTGGG - Intergenic
975934496 4:79562081-79562103 GGGCAGGAAGCATCCAGTGTAGG - Intergenic
976828445 4:89285493-89285515 GGGCAGGAAGAACCCCCAGGTGG + Intronic
978855138 4:113386125-113386147 GGGCAGGAAGCATCCAGTGTGGG + Intergenic
982094917 4:151912743-151912765 AGGGAGGAGGGCCCCACTGTTGG + Intergenic
985213386 4:187620018-187620040 GGGCACCCAGAGCCCACTGTTGG - Intergenic
985947074 5:3194145-3194167 GAGCAGGAAGATCCCACTCCAGG - Intergenic
986158275 5:5198811-5198833 GGACAGGAAGACACCAGTGTAGG - Intronic
986876364 5:12115815-12115837 GTGCAGAAAGACCCCAATGAAGG + Intergenic
987076300 5:14385153-14385175 GGGCAGGAAGATGCCACCGGAGG - Intronic
989120495 5:37999696-37999718 GGCCAGCAAAACCCCACTGGGGG - Intergenic
990646296 5:57848366-57848388 AGGCAGGAAGACTCCAAGGTGGG - Intergenic
992891250 5:81206429-81206451 GGGCAGGGAAAGCCCACGGTAGG + Intronic
999302101 5:150497619-150497641 GGGCAAGATGAGCCCACTGGTGG + Intronic
1001720947 5:173856528-173856550 GGGCAGGCAGCTCCCACTTTGGG - Intergenic
1002192843 5:177487787-177487809 GGGCAGGGAGAGCCCAAAGTGGG + Intronic
1002895574 6:1378350-1378372 GGGCAGGCTGACCTCACCGTGGG - Intergenic
1005083505 6:21980835-21980857 GAGCAGGCAGACCCCAGTGCAGG - Intergenic
1006092688 6:31637278-31637300 GGTGCGGAAGACTCCACTGTAGG - Exonic
1006378654 6:33685273-33685295 GGGCAGGCACACCACACTGCTGG - Intronic
1006845421 6:37058031-37058053 GAGAAGCAAGACCCCACGGTGGG - Intergenic
1008760787 6:54849249-54849271 GGGAAGGAAGCTCCCACTGAAGG - Intronic
1010131300 6:72496971-72496993 GGGCAGGAAGACATCAATGTAGG - Intergenic
1010617649 6:78031904-78031926 GGGCAGGAAGTACCCAGCGTGGG + Intergenic
1013430548 6:110051454-110051476 GGGAGGGGAGTCCCCACTGTGGG - Intergenic
1017765964 6:157607522-157607544 GGCCAGGCAGGCCACACTGTAGG - Intronic
1019314057 7:376496-376518 GGGCAGGAAGGGCCCAGGGTGGG - Intergenic
1019374023 7:679467-679489 GGGGAGGAAGACCCCAGAGGTGG + Intronic
1019530059 7:1498893-1498915 CGGCAGGAAGACCACGCTGTGGG + Intronic
1019812039 7:3171954-3171976 GGGTAGGTAGGTCCCACTGTGGG - Intronic
1019818127 7:3216442-3216464 CGGCAGGCAGACCTCACTGTTGG - Intergenic
1022101949 7:27174109-27174131 CGGCAGGTAGACCCCGCCGTGGG + Exonic
1023768528 7:43533808-43533830 AGGCAGGAAGACCCAGCTTTGGG + Intronic
1024492159 7:49997701-49997723 TGGAAGGGAGGCCCCACTGTAGG + Intronic
1026261675 7:68760923-68760945 GGGCAGGAAGCATCCACCGTGGG + Intergenic
1027759315 7:82257987-82258009 GTGGAGGGAGACCCCAGTGTTGG + Intronic
1029294124 7:99525965-99525987 TGGCAGGTCAACCCCACTGTGGG + Exonic
1033291794 7:140091387-140091409 GAGCAGGCAGACCAGACTGTGGG - Intronic
1033904635 7:146187312-146187334 TGGGAGGTAGACCACACTGTTGG + Intronic
1037969726 8:23163644-23163666 GGGCAGGACGAACCCGCCGTCGG - Intronic
1038006755 8:23437051-23437073 GGGCTGGTAGACCCCATTGAGGG + Exonic
1038245473 8:25850725-25850747 GTGCTGGAAGACCCAACGGTGGG + Exonic
1042513777 8:69638495-69638517 GCACAGAAAGATCCCACTGTTGG - Exonic
1043946960 8:86264397-86264419 GGGCAGGAAGAACCCACATTAGG - Intronic
1045324576 8:101108919-101108941 GGGCAGGAAGGACCCACTTCCGG - Intergenic
1045459001 8:102411483-102411505 GGGCAGGCAAACCTCACTGCAGG + Intronic
1049252364 8:141596187-141596209 GGGCAGGAAGCCCCCAGGCTAGG - Intergenic
1049543618 8:143219526-143219548 GGGCAGGAAGAGACCACTGTGGG - Intergenic
1050334046 9:4573820-4573842 GGGAAGGAACACTCCAGTGTGGG - Intronic
1053572309 9:39321481-39321503 GGGCAGGCAAACCCCAAAGTGGG - Intergenic
1054124836 9:61297530-61297552 GGGCAGGCAAACCCCAAAGTGGG + Intergenic
1060408041 9:123382331-123382353 AGGCAGGAAGACCCCAGAGCTGG - Exonic
1061262724 9:129488806-129488828 GGGCAGGACGACACCGCTGGGGG + Intergenic
1061879557 9:133561995-133562017 TGGCAGGGAGACCCCAGTGCCGG + Intronic
1186167630 X:6843780-6843802 GAGCAGGAAGACTGCACTGATGG - Intergenic
1189192305 X:39121153-39121175 GGGCAGCCAGAACCAACTGTGGG + Intergenic
1190981808 X:55463113-55463135 GGGCAGGGAGGCCTCACTGCAGG - Intergenic
1190986890 X:55510067-55510089 GGGCAGGGAGGCCTCACTGCAGG + Intergenic
1193470513 X:81896493-81896515 GGGCAGGAAGCCTCCAGTATAGG - Intergenic
1197156233 X:123273026-123273048 GAGCAGGAAGGCCGGACTGTAGG - Intronic
1197890933 X:131269703-131269725 GGGCAGCCAGATCACACTGTTGG - Intergenic