ID: 929454256

View in Genome Browser
Species Human (GRCh38)
Location 2:42055054-42055076
Sequence CTGGCGGGTGGGGGTGGGGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2827
Summary {0: 1, 1: 7, 2: 45, 3: 377, 4: 2397}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
929454256_929454272 12 Left 929454256 2:42055054-42055076 CCTACCCCACCCCCACCCGCCAG 0: 1
1: 7
2: 45
3: 377
4: 2397
Right 929454272 2:42055089-42055111 GAAAAATAACCCAGGGCAGCAGG 0: 1
1: 0
2: 4
3: 23
4: 275
929454256_929454274 14 Left 929454256 2:42055054-42055076 CCTACCCCACCCCCACCCGCCAG 0: 1
1: 7
2: 45
3: 377
4: 2397
Right 929454274 2:42055091-42055113 AAAATAACCCAGGGCAGCAGGGG 0: 1
1: 3
2: 1
3: 20
4: 286
929454256_929454273 13 Left 929454256 2:42055054-42055076 CCTACCCCACCCCCACCCGCCAG 0: 1
1: 7
2: 45
3: 377
4: 2397
Right 929454273 2:42055090-42055112 AAAAATAACCCAGGGCAGCAGGG 0: 1
1: 0
2: 7
3: 25
4: 579
929454256_929454270 4 Left 929454256 2:42055054-42055076 CCTACCCCACCCCCACCCGCCAG 0: 1
1: 7
2: 45
3: 377
4: 2397
Right 929454270 2:42055081-42055103 AGTGGGGAGAAAAATAACCCAGG 0: 1
1: 0
2: 2
3: 36
4: 311
929454256_929454271 5 Left 929454256 2:42055054-42055076 CCTACCCCACCCCCACCCGCCAG 0: 1
1: 7
2: 45
3: 377
4: 2397
Right 929454271 2:42055082-42055104 GTGGGGAGAAAAATAACCCAGGG 0: 1
1: 1
2: 2
3: 25
4: 295

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
929454256 Original CRISPR CTGGCGGGTGGGGGTGGGGT AGG (reversed) Intronic
Too many off-targets to display for this crispr