ID: 929464263

View in Genome Browser
Species Human (GRCh38)
Location 2:42130679-42130701
Sequence AAGTCATATTTTAATTTAGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
929464263_929464264 -2 Left 929464263 2:42130679-42130701 CCAACTAAATTAAAATATGACTT No data
Right 929464264 2:42130700-42130722 TTTGCTTTTGTTATTCAGAGTGG No data
929464263_929464265 18 Left 929464263 2:42130679-42130701 CCAACTAAATTAAAATATGACTT No data
Right 929464265 2:42130720-42130742 TGGCTCCAGTCCCCTTTTTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
929464263 Original CRISPR AAGTCATATTTTAATTTAGT TGG (reversed) Intergenic
No off target data available for this crispr