ID: 929470078 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 2:42182918-42182940 |
| Sequence | CCTTATAAGAAGAGGAAATC TGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 3138 | |||
| Summary | {0: 9, 1: 140, 2: 478, 3: 958, 4: 1553} |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 929470078_929470082 | -1 | Left | 929470078 | 2:42182918-42182940 | CCAGATTTCCTCTTCTTATAAGG | 0: 9 1: 140 2: 478 3: 958 4: 1553 |
||
| Right | 929470082 | 2:42182940-42182962 | GATACCAGTTGTATTGGATGAGG | 0: 1 1: 6 2: 34 3: 179 4: 971 |
||||
| 929470078_929470081 | -7 | Left | 929470078 | 2:42182918-42182940 | CCAGATTTCCTCTTCTTATAAGG | 0: 9 1: 140 2: 478 3: 958 4: 1553 |
||
| Right | 929470081 | 2:42182934-42182956 | TATAAGGATACCAGTTGTATTGG | 0: 2 1: 27 2: 116 3: 723 4: 1751 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 929470078 | Original CRISPR | CCTTATAAGAAGAGGAAATC TGG (reversed) | Intronic | ||
| Too many off-targets to display for this crispr | |||||