ID: 929470078

View in Genome Browser
Species Human (GRCh38)
Location 2:42182918-42182940
Sequence CCTTATAAGAAGAGGAAATC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 3138
Summary {0: 9, 1: 140, 2: 478, 3: 958, 4: 1553}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
929470078_929470082 -1 Left 929470078 2:42182918-42182940 CCAGATTTCCTCTTCTTATAAGG 0: 9
1: 140
2: 478
3: 958
4: 1553
Right 929470082 2:42182940-42182962 GATACCAGTTGTATTGGATGAGG 0: 1
1: 6
2: 34
3: 179
4: 971
929470078_929470081 -7 Left 929470078 2:42182918-42182940 CCAGATTTCCTCTTCTTATAAGG 0: 9
1: 140
2: 478
3: 958
4: 1553
Right 929470081 2:42182934-42182956 TATAAGGATACCAGTTGTATTGG 0: 2
1: 27
2: 116
3: 723
4: 1751

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
929470078 Original CRISPR CCTTATAAGAAGAGGAAATC TGG (reversed) Intronic
Too many off-targets to display for this crispr