ID: 929474213 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 2:42229396-42229418 |
| Sequence | GGTGCTTAAGAGCACAGTGC TGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 183 | |||
| Summary | {0: 1, 1: 0, 2: 2, 3: 14, 4: 166} |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 929474213_929474215 | 28 | Left | 929474213 | 2:42229396-42229418 | CCAGCACTGTGCTCTTAAGCACC | 0: 1 1: 0 2: 2 3: 14 4: 166 |
||
| Right | 929474215 | 2:42229447-42229469 | ACACATGAACTTTGTATTCCAGG | 0: 1 1: 0 2: 4 3: 15 4: 179 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 929474213 | Original CRISPR | GGTGCTTAAGAGCACAGTGC TGG (reversed) | Intronic | ||