ID: 929474213

View in Genome Browser
Species Human (GRCh38)
Location 2:42229396-42229418
Sequence GGTGCTTAAGAGCACAGTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 183
Summary {0: 1, 1: 0, 2: 2, 3: 14, 4: 166}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
929474213_929474215 28 Left 929474213 2:42229396-42229418 CCAGCACTGTGCTCTTAAGCACC 0: 1
1: 0
2: 2
3: 14
4: 166
Right 929474215 2:42229447-42229469 ACACATGAACTTTGTATTCCAGG 0: 1
1: 0
2: 4
3: 15
4: 179

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
929474213 Original CRISPR GGTGCTTAAGAGCACAGTGC TGG (reversed) Intronic