ID: 929477769

View in Genome Browser
Species Human (GRCh38)
Location 2:42270117-42270139
Sequence TCTAAGCCTAAATATGTGTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 118
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 110}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
929477769_929477772 27 Left 929477769 2:42270117-42270139 CCTTACACATATTTAGGCTTAGA 0: 1
1: 0
2: 0
3: 7
4: 110
Right 929477772 2:42270167-42270189 ACTTTCTGAAAGCTTTTTCTTGG 0: 1
1: 1
2: 4
3: 39
4: 409
929477769_929477771 2 Left 929477769 2:42270117-42270139 CCTTACACATATTTAGGCTTAGA 0: 1
1: 0
2: 0
3: 7
4: 110
Right 929477771 2:42270142-42270164 AGATATCACTAAGGTCTTTTTGG 0: 1
1: 0
2: 2
3: 10
4: 184
929477769_929477770 -7 Left 929477769 2:42270117-42270139 CCTTACACATATTTAGGCTTAGA 0: 1
1: 0
2: 0
3: 7
4: 110
Right 929477770 2:42270133-42270155 GCTTAGATTAGATATCACTAAGG 0: 1
1: 0
2: 0
3: 5
4: 99

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
929477769 Original CRISPR TCTAAGCCTAAATATGTGTA AGG (reversed) Intronic
900698747 1:4030241-4030263 ATTAAGCCTAAATATCTGTAGGG + Intergenic
901366414 1:8754154-8754176 TTTAAGCCCTAATATGTGTTAGG + Intronic
907075533 1:51574751-51574773 ACTAAACATAAATATGTGTAAGG - Intergenic
912722312 1:112030561-112030583 TCTAAGCCTAAATGCATATAGGG - Intergenic
914781363 1:150788480-150788502 TTTAAGACTAAATAAGGGTAGGG - Intergenic
915122348 1:153637907-153637929 TCTAAGGCCAAATATGAGGAAGG - Intronic
916999225 1:170338072-170338094 TTGAAGCCTCAATATGTGTGTGG - Intergenic
919622158 1:199875054-199875076 TCTAAACTTAAATATGTGTTGGG + Intergenic
919683878 1:200462525-200462547 TCTAAGCCTAAATCTAGGTTTGG - Intergenic
923102409 1:230826970-230826992 TCTAAGATTCAAGATGTGTAGGG + Intergenic
924925176 1:248672177-248672199 TCTCAGCCTACATAATTGTAAGG + Intergenic
1062787947 10:280865-280887 TCTGTGCCTACATATGTGTGAGG + Intronic
1063270541 10:4505661-4505683 TCAAAGCAGAAATATGTCTATGG + Intergenic
1065882790 10:30051123-30051145 TCTTAGCTTATTTATGTGTATGG - Intronic
1079951577 11:26811862-26811884 TCAAAGCATAAATAAGTGAATGG + Intergenic
1080176220 11:29366065-29366087 TCTAGGGTTAAATATCTGTAAGG + Intergenic
1080495880 11:32818466-32818488 TTTAAGGCTTAATATGTGTGTGG - Intergenic
1082051128 11:47771178-47771200 TCTAAGCCTTCATATCTGGAAGG - Intergenic
1086394129 11:86396851-86396873 CCTAAGCCAAAATATGTCAAAGG - Intronic
1091901086 12:4144626-4144648 CCTTAGAATAAATATGTGTAAGG - Intergenic
1093662825 12:21776337-21776359 TGTAAGCCTAGATATATTTAGGG + Intergenic
1094672096 12:32580222-32580244 TCTAAGCCTAGATTTCTCTATGG + Intronic
1095427943 12:42098174-42098196 TCTAACCCTAAATGTGAGAAGGG + Intronic
1097047366 12:56197247-56197269 GCTAGGGCTAAAGATGTGTATGG - Intergenic
1098541314 12:71661327-71661349 TTTAAGCATATATATGTGTATGG - Intronic
1100008859 12:89928410-89928432 TCAAAGCCTATTTATGTATATGG + Intergenic
1100783326 12:98052644-98052666 TGTAAGCCCAGATATGTGTGGGG - Intergenic
1101044787 12:100793985-100794007 TATAAGACAAAATATGTGTTTGG - Intronic
1101460522 12:104887227-104887249 TGAAAGCCTAAATATGGCTATGG + Intronic
1102366572 12:112341722-112341744 GCTAAGACTTAATATGTGTTGGG + Intronic
1102550849 12:113691127-113691149 TTTTAGCCTACATATGTGTGAGG - Intergenic
1106516369 13:30458066-30458088 TCTAAGACTTAAGCTGTGTACGG + Exonic
1109674778 13:65661647-65661669 TCTCAGCCTAAAAACATGTAGGG - Intergenic
1113125540 13:106974753-106974775 TCTAACACTAAATAAGTGCAAGG + Intergenic
1113177971 13:107588192-107588214 TCTCAGCTGAAATGTGTGTATGG - Intronic
1114911092 14:27198279-27198301 GATAAGCTGAAATATGTGTAGGG + Intergenic
1115678522 14:35709911-35709933 TCTATTCCTAAAAATGTTTAAGG + Intronic
1116050672 14:39799276-39799298 TCTAAGTCTAAGTATGTTTTTGG + Intergenic
1123912457 15:24981658-24981680 ACTAAGCATTATTATGTGTATGG - Intergenic
1124645905 15:31437361-31437383 TCAAAGTCTAAATATCTGTGGGG + Intergenic
1125058887 15:35395046-35395068 TCTGAAATTAAATATGTGTAAGG + Intronic
1129480477 15:75821274-75821296 TTTAATCCTACATATTTGTAAGG + Intergenic
1131686974 15:94778816-94778838 TCTGTGCCTAAAAAAGTGTATGG + Intergenic
1138175211 16:54891709-54891731 TTTAACCCTAAAGATGGGTATGG - Intergenic
1146679177 17:34794838-34794860 TCTAAGCCTACATATGTTATAGG + Intergenic
1155677217 18:28443851-28443873 TTGAAGACTAAATAAGTGTAGGG + Intergenic
1158840855 18:61385414-61385436 TATAAGCATAAATATATGAAAGG + Intronic
1159478217 18:68951969-68951991 TTAAAGTTTAAATATGTGTATGG - Intronic
1160321598 18:77900819-77900841 TCAGAGCATAAATAGGTGTATGG + Intergenic
1161219522 19:3111959-3111981 TCTAAGCCCAAATATGAATATGG - Intronic
1164611487 19:29635396-29635418 TCTATGCCTGCAGATGTGTATGG - Intergenic
1164766103 19:30771945-30771967 TCTAAGACTAAAATTGTATAAGG - Intergenic
925345561 2:3169773-3169795 ACGGAGCCTAAATATGTGGAGGG - Intergenic
928072495 2:28231398-28231420 TGTATGCCTAACTATGTCTAAGG - Intronic
929477769 2:42270117-42270139 TCTAAGCCTAAATATGTGTAAGG - Intronic
933335682 2:80955933-80955955 ACTCAGCATAAGTATGTGTAAGG - Intergenic
937500498 2:122473337-122473359 TCAAATCCTAAATATGTCTGTGG - Intergenic
939763320 2:146212266-146212288 TATAATTCTCAATATGTGTATGG + Intergenic
940742850 2:157531007-157531029 CCAAAGCCAAAATATCTGTAAGG + Exonic
941600030 2:167531255-167531277 TCTCAGCATAAATCTGTGTGAGG + Intergenic
943487107 2:188499528-188499550 TAAAAGCATAAATATATGTAAGG - Intronic
944689990 2:202150001-202150023 TGTAAGTCTAGATATTTGTACGG + Intronic
945513136 2:210727472-210727494 TCTAAGCCTAATTACCTGAAAGG - Intergenic
945589506 2:211712693-211712715 TTTAAGCATAAATATTTGAATGG - Intronic
1168870112 20:1120306-1120328 TCTAAGACTAGATATGAGGATGG + Intronic
1174439255 20:50535992-50536014 TCTAGGCATTAAAATGTGTAAGG + Intronic
1174963470 20:55184647-55184669 TCTAAGAAGAAAGATGTGTATGG + Intergenic
1174967690 20:55237296-55237318 TCAAAATCTAAATATGTGTAAGG + Intergenic
1176896549 21:14385059-14385081 TCTGAGCTAAGATATGTGTATGG - Intergenic
1181416494 22:22763147-22763169 ACTGAGCCTAAATATGAGAAAGG - Intronic
1181659447 22:24332859-24332881 TCTACTCCTAAAAATGAGTAAGG - Intronic
1183846833 22:40548411-40548433 TCTAACACTAAATATGAGTTAGG + Intronic
950325386 3:12104265-12104287 ACTCAGACAAAATATGTGTAAGG + Intronic
951822806 3:26832216-26832238 GCTAAGCCTCTATATGAGTAAGG + Intergenic
952515665 3:34102592-34102614 TCTGTGCCTAAATGTGTTTAAGG - Intergenic
956495111 3:69816769-69816791 AATGAGCCTTAATATGTGTAAGG - Intronic
956948456 3:74252332-74252354 ACTCATGCTAAATATGTGTATGG + Intergenic
957823666 3:85412153-85412175 TCAAATTCTATATATGTGTAAGG - Intronic
960361163 3:116713584-116713606 TTTAAGCCTAAATCTGTAGAAGG + Intronic
963597196 3:147343335-147343357 TCTAAGAGTAAAAATGTGCATGG - Intergenic
970006243 4:11413541-11413563 TCAAGGCCTAAATAAATGTACGG + Intronic
970708610 4:18835427-18835449 TTTAAGCTTAAATAACTGTAAGG - Intergenic
971274052 4:25178627-25178649 TATAAGCCATAATATATGTAAGG + Intronic
972015469 4:34238177-34238199 TTTAAGCCTAAATATTTTGAGGG - Intergenic
977175197 4:93811174-93811196 TTTAAGCCTAACTATATATATGG - Intergenic
979148040 4:117270980-117271002 TCAAAGCATATATATGTGTGTGG + Intergenic
980811152 4:137882281-137882303 TGAAAGCCTATATATGTGAATGG + Intergenic
983022097 4:162690127-162690149 ACAAAGACTATATATGTGTAAGG - Intergenic
983561775 4:169108838-169108860 TCTAAGCTTTAGTAGGTGTAGGG - Intronic
992640355 5:78763564-78763586 TCTAAGCCTAACTCTTTTTAGGG + Intronic
995289993 5:110441141-110441163 TCTAAGCCCAAATATCAATATGG - Intronic
995846909 5:116503245-116503267 TCGAAGCATAAATCTGTGAATGG - Intronic
999146598 5:149400035-149400057 TTCAACCCTAAACATGTGTAAGG - Intronic
999676291 5:154006442-154006464 TCTTTGCCTAACTATTTGTATGG - Intronic
999792941 5:154959463-154959485 TCTAATCCTAGCTATGTGGAAGG - Intronic
1010265313 6:73859272-73859294 TGGAAAGCTAAATATGTGTATGG + Intergenic
1013887409 6:114987246-114987268 TCTAAGGATATATATTTGTAAGG + Intergenic
1014650516 6:124030753-124030775 TCTAAGCCTAAGTTAGTGTCTGG + Intronic
1016131750 6:140481734-140481756 TATAAGCCTTAAAATGTGTCTGG + Intergenic
1017023950 6:150165403-150165425 TCTAGGCCCAAATATGTTTCTGG + Intronic
1019215693 6:170441977-170441999 GCTAAATCTAAATTTGTGTAAGG + Intergenic
1022566804 7:31412209-31412231 TCAAAGCCTAAATATGTCTGAGG + Intergenic
1023072106 7:36445982-36446004 TCTAAGCATAAGAGTGTGTATGG + Intronic
1031348107 7:120694149-120694171 CCTAAGCCTATTTGTGTGTAGGG + Intronic
1031365122 7:120891497-120891519 TCTTTGCCTAAATAAGTCTAAGG - Intergenic
1034879304 7:154751263-154751285 ACTAAGCCCAAAGATGTGTTAGG + Intronic
1035024938 7:155819061-155819083 TCAAAGCCCAAATGTGTGTTCGG - Intergenic
1040089688 8:43385069-43385091 TCTAAGGCTAAATATATTTTTGG - Intergenic
1042005564 8:64176272-64176294 TCAAAGTCTAAATATCTGTTTGG + Intergenic
1045690033 8:104750980-104751002 ACTTAACCAAAATATGTGTAGGG + Intronic
1045975932 8:108131034-108131056 TGTAAGTCTGCATATGTGTAGGG - Intergenic
1051922627 9:22285858-22285880 TCTATGCCTAAACATGTATTTGG + Intergenic
1052619869 9:30893102-30893124 TCGTAGCCAAATTATGTGTAAGG + Intergenic
1059354024 9:113686071-113686093 TTTATGCATATATATGTGTATGG - Intergenic
1060284566 9:122237571-122237593 TCTATCCCAAAAGATGTGTAAGG + Intergenic
1192040039 X:67610049-67610071 ATTAAGCCTAAAAATGTTTAAGG - Intronic
1195769565 X:108335860-108335882 TCTAATGCTTAATATGTGTCAGG + Intronic
1198213539 X:134536491-134536513 TCTAAACCTAAAGCTGTATATGG - Intergenic